Emmanuel Fernandez

Appearances Can Be Deceptive: Revealing a Hidden Viral Infection with Deep Sequencing in a Plant Quarantine Context

Comprehensive inventories of plant viral diversity are essential for effective quarantine and sanitation efforts. The safety of regulated plant material exchanges presently relies heavily on techniques such as PCR or nucleic acid hybridisation, which are only suited to the detection and characterisation of specific, well characterised pathogens. Here, we demonstrate the utility of sequence-independent next generation sequencing (NGS) of both virus-derived small interfering RNAs (siRNAs) and virion-associated nucleic acids (VANA) for the detailed identification and characterisation of viruses infecting two quarantined sugarcane plants. Both plants originated from Egypt and were known to be infected with Sugarcane streak Egypt Virus (SSEV; Genus Mastrevirus, Family Geminiviridae), but were revealed by the NGS approaches to also be infected by a second highly divergent mastrevirus, here named Sugarcane white streak Virus (SWSV). This novel virus had escaped detection by all routine quarantine detection assays and was found to also be present in sugarcane plants originating from Sudan. Complete SWSV genomes were cloned and sequenced from six plants and all were found to share >91% genome-wide identity. With the exception of two SWSV variants, which potentially express unusually large RepA proteins, the SWSV isolates display genome characteristics very typical to those of all other previously described mastreviruses. An analysis of virus-derived siRNAs for SWSV and SSEV showed them to be strongly influenced by secondary structures within both genomic single stranded DNA and mRNA transcripts. In addition, the distribution of siRNA size frequencies indicates that these mastreviruses are likely subject to both transcriptional and post-transcriptional gene silencing. Our study stresses the potential advantages of NGS-based virus metagenomic screening in a plant quarantine setting and indicates that such techniques could dramatically reduce the numbers of non-intercepted virus pathogens passing through plant quarantine stations.

Alfalfa Leaf Curl Virus: an Aphid-Transmitted Geminivirus

ABSTRACT The family Geminiviridae comprises seven genera differentiated by genome organization, sequence similarity, and insect vector. Capulavirus, an eighth genus, has been proposed to accommodate two newly discovered highly divergent geminiviruses that presently have no known vector. Alfalfa leaf curl virus, identified here as a third capulavirus, is shown to be transmitted by Aphis craccivora. This is the first report of an aphid-transmitted geminivirus.

Molecular characterization and prevalence of two capulaviruses: Alfalfa leaf curl virus from France and Euphorbia caput-medusae latent virus from South Africa

Little is known about the prevalence, diversity, evolutionary processes, genomic structures and population dynamics of viruses in the divergent geminivirus lineage known as the capulaviruses. We determined and analyzed full genome sequences of 13 Euphorbia caput-medusae latent virus (EcmLV) and 26 Alfalfa leaf curl virus (ALCV) isolates, and partial genome sequences of 23 EcmLV and 37 ALCV isolates. While EcmLV was asymptomatic in uncultivated southern African Euphorbia caput-medusae, severe alfalfa disease symptoms were associated with ALCV in southern France. The prevalence of both viruses exceeded 10% in their respective hosts. Besides using patterns of detectable negative selection to identify ORFs that are probably functionally expressed, we show that ALCV and EcmLV both display evidence of inter-species recombination and biologically functional genomic secondary structures. Finally, we show that whereas the EcmLV populations likely experience restricted geographical dispersion, ALCV is probably freely moving across the French Mediterranean region.

Metagenomic-based screening and molecular characterization of cowpea-infecting viruses in Burkina Faso

Cowpea, (Vigna unguiculata L. (Walp)) is an annual tropical grain legume. Often referred to as “poor man’s meat”, cowpea is one of the most important subsistence legumes cultivated in West Africa due to the high protein content of its seeds. However, African cowpea production can be seriously constrained by viral diseases that reduce yields. While twelve cowpea-infecting viruses have been reported from Africa, only three of these have so-far been reported from Burkina Faso. Here we use a virion-associated nucleic acids (VANA)-based metagenomics method to screen for the presence of cowpea viruses from plants collected from the three agro-climatic zones of Burkina Faso. Besides the three cowpea-infecting virus species which have previously been reported from Burkina Faso (Cowpea aphid borne mosaic virus [Family Potyviridae], the Blackeye cowpea mosaic virus—a strain of Bean common mosaic virus—[Family Potyviridae] and Cowpea mottle virus [Family Tombusviridae]) five additional viruses were identified: Southern cowpea mosaic virus (Sobemovirus genus), two previously uncharacterised polerovirus-like species (Family Luteoviridae), a previously uncharacterised tombusvirus-like species (Family Tombusviridae) and a previously uncharacterised mycotymovirus-like species (Family Tymoviridae). Overall, potyviruses were the most prevalent cowpea viruses (detected in 65.5% of samples) and the Southern Sudan zone of Burkina Faso was found to harbour the greatest degrees of viral diversity and viral prevalence. Partial genome sequences of the two novel polerovirus-like and tombusvirus-like species were determined and RT-PCR primers were designed for use in Burkina Faso to routinely detect all of these cowpea-associated viruses.

Geometagenomics illuminates the impact of agriculture on the distribution and prevalence of plant viruses at the ecosystem scale

Disease emergence events regularly result from human activities such as agriculture, which frequently brings large populations of genetically uniform hosts into contact with potential pathogens. Although viruses cause nearly 50% of emerging plant diseases, there is little systematic information about virus distribution across agro-ecological interfaces and large gaps in understanding of virus diversity in nature. Here we applied a novel landscape-scale geometagenomics approach to examine relationships between agricultural land use and distributions of plant-associated viruses in two Mediterranean-climate biodiversity hotspots (Western Cape region of South Africa and Rhône river delta region of France). In total, we analysed 1725 geo-referenced plant samples collected over two years from 4.5 × 4.5 km2 grids spanning farmlands and adjacent uncultivated vegetation. We found substantial virus prevalence (25.8–35.7%) in all ecosystems, but prevalence and identified family-level virus diversity were greatest in cultivated areas, with some virus families displaying strong agricultural associations. Our survey revealed 94 previously unknown virus species, primarily from uncultivated plants. This is the first effort to systematically evaluate plant-associated viromes across broad agro-ecological interfaces. Our findings indicate that agriculture substantially influences plant virus distributions and highlight the extent of current ignorance about the diversity and roles of viruses in nature.

Occurrence of a novel mastrevirus in sugarcane germplasm collections in Florida, Guadeloupe and Réunion

BackgroundIn Africa and Asia, sugarcane is the host of at least seven different virus species in the genus Mastrevirus of the family Geminiviridae. However, with the exception of Sugarcane white streak virus in Barbados, no other sugarcane-infecting mastrevirus has been reported in the New World. Conservation and exchange of sugarcane germplasm using stalk cuttings facilitates the spread of sugarcane-infecting viruses.MethodsA virion-associated nucleic acids (VANA)-based metagenomics approach was used to detect mastrevirus sequences in 717 sugarcane samples from Florida (USA), Guadeloupe (French West Indies), and Réunion (Mascarene Islands). Contig assembly was performed using CAP3 and sequence searches using BLASTn and BLASTx. Mastrevirus full genomes were enriched from total DNA by rolling circle amplification, cloned and sequenced. Nucleotide and amino acid sequence identities were determined using SDT v1.2. Phylogenetic analyses were conducted using MEGA6 and PHYML3.ResultsWe identified a new sugarcane-infecting mastrevirus in six plants sampled from germplasm collections in Florida and Guadeloupe. Full genome sequences were determined and analyzed for three virus isolates from Florida, and three from Guadeloupe. These six genomes share >88% genome-wide pairwise identity with one another and between 89 and 97% identity with a recently identified mastrevirus (KR150789) from a sugarcane plant sampled in China. Sequences similar to these were also identified in sugarcane plants in Réunion.ConclusionsAs these virus isolates share <64% genome-wide identity with all other known mastreviruses, we propose classifying them within a new mastrevirus species named Sugarcane striate virus. This is the first report of sugarcane striate virus (SCStV) in the Western Hemisphere, a virus that most likely originated in Asia. The distribution, vector, and impact of SCStV on sugarcane production remains to be determined.

Viral Metagenomics Approaches for High-Resolution Screening of Multiplexed Arthropod and Plant Viral Communities

Viral metagenomic approaches have become essential for culture-independent and sequence-independent viral detection and characterization. This chapter describes an accurate and efficient approach to (1) concentrate viral particles from arthropods and plants, (2) remove contaminating non-encapsidated nucleic acids, (3) extract and amplify both viral DNA and RNA, and (4) analyze high-throughput sequencing (HTS) data by bioinformatics. Using this approach, up to 96 arthropod or plant samples can be multiplexed in a single HTS library.

First report of #Leifsonia xyli# subsp. #xyli#, causal agent of ratoon stunting of sugarcane, in Jamaica

To our knowledge, this is the first report that Leifsonia xyli subsp. xyli, previously named Clavibacter xyli subsp. xyli (2), has been detected and identified in sugarcane in Jamaica. Although ratoon stunting (also known as ratoon stunting disease or RSD) has been reported in Jamaica since 1961, presence of the pathogen had never been confirmed in symptomatic tissues. A major industry-wide survey conducted in 1987 using the fluorescent antibody staining technique failed to detect positives in any of the 61 fields sampled in Jamaica. A new survey was conducted in 2004 on eight estates and the Sugar Industry Research Institute (SIRI) in Jamaica. Six arbitrarily selected stalks were sampled from each of 64 fields representing 25 different sugarcane cultivars. A 1-cm diameter core was extracted from the center of the bottom part of the stalk and used to detect the pathogen by tissue blot immunoassay (TBIA) (3). L. xyli subsp. xyli was detected in 26 of 384 samples (7%). At least one positive sample was found in 10 fields and seven cultivars and in one case (sugarcane cv. D14146 at the St Thomas Sugar Estate), all six stalks sampled in a field were positive. The highest number of infected fields (6 of 10) occurred at Worthy Park where cane yield in 2004 was 86.54 tons per ha compared with an average of 68.04 tons per ha for major estates in Jamaica (1). This latter result would indicate that where good quality agronomic practices are maintained, the effect of ratoon stunting might not be substantial or that sugarcane cultivars grown at this location were resistant to ratoon stunting. Pathogen identification was confirmed using nested polymerase chain reaction (PCR) with three samples from a TBIA-positive field of cv. D14146. Primary primers were RSD 33 (CTGGCACCCTGTGTTGTTTTC) and RSD 297 (TTCGGTTCTCATCTCAGCGTC) and secondary, nested primers were RST60 (TCAACGCAGAGATTGTCCAG) and RST59 (CGTCTTGAAGACACAGCGATGAG). The thermocycler parameters were denaturization at 94°C for 4 min, 31 cycles at 94°C for 30 s, 55°C for 30 s, 65°C for 1 min, and final extension at 65°C for 3 min. The nested-PCR product (approximately 230 bp) of each sample was cloned and sequenced. It showed 99 to 100% identity with the 16S-23S intergenic spacer region of L. xyli subsp. xyli, thus confirming occurrence of ratoon stunting in Jamaica. Since this study, the SIRI has installed a hot-water treatment plant and will heat-treat cuttings before planting the nurseries with new sugarcane clones selected for release to growers. The SIRI will also conduct screening for ratoon stunting resistance to ensure that susceptible clones are not released to the industry. Meanwhile, the SIRI will do a more intense survey so that a more comprehensive picture may be obtained of the presence of ratoon stunting in Jamaica. References: (1) Anonymous. Annual Report of the Sugar Industry Research Institute, Jamaica, 2004. (2) L. I. Evtushenko et al. Int. J. Syst. Evol. Microbiol. 50:371, 2000. (3) N. A. Harrison and M. J. Davis. Phytopathology 78:722, 1988.