F. K. Khasanov

Homologous recombination between plasmid and chromosomal DNA in Bacillus subtilis requires approximately 70 bp of homology

SummaryTo determine the minimal DNA sequence homology required for recombination in Bacillus subtilis, we developed a system capable of distinguishing between homologous and illegitimate recombination events during plasmid integration into the chromosome. In this system the recombination frequencies were measured between is pE194 derivatives carrying segments of the chromosomal β-gluconase gene (bglS) of various lengths and the bacterial chromosome, using selection for erythromycin resistance at the non-permissive temperature. Homologous recombination events, resulting in disruption of the bglS gene, were easily detected by a colorimetric assay for β-gluconase activity. A linear dependence of recombination frequency on homology length was observed over an interval of 77 bp. It was found that approximately 70 bp of homology is required for detectable homologous recombination. Homologous recombination was not detected when only 25 by of homology between plasmid and chromosome were provided. The data indicate that homology requirements for recombination in B. subtilis differ from those in Escherichia coli.

Genetic analysis reveals different roles of Schizosaccharomyces pombesfr1/dds20 in meiotic and mitotic DNA recombination and repair

DNA double-strand break (DSB) repair mediated by the Rad51 pathway of homologous recombination is conserved in eukaryotes. In yeast, Rad51 paralogs, Saccharomyces cerevisiae Rad55–Rad57 and Schizosaccharomyces pombe Rhp55–Rhp57, are mediators of Rad51 nucleoprotein formation. The recently discovered S. pombe Sfr1/Dds20 protein has been shown to interact with Rad51 and to operate in the Rad51-dependent DSB repair pathway in parallel to the paralog-mediated pathway. Here we show that Sfr1 is a nuclear protein and acts downstream of Rad50 in DSB processing. sfr1Δ is epistatic to rad18− and rad60−, and Sfr1 is a high-copy suppressor of the replication and repair defects of a rad60 mutant. Sfr1 functions in a Cds1-independent UV damage tolerance mechanism. In contrast to mitotic recombination, meiotic recombination is significantly reduced in sfr1Δ strains. Our data indicate that Sfr1 acts in DSB repair mainly outside of S-phase, and is required for wild-type levels of meiotic recombination. We suggest that Sfr1 acts early in recombination and has a specific role in Rad51 filament assembly, distinct from that of the Rad51 paralogs.

[The dds20+ gene controls a novel Rad51Sp-dependent pathway of recombinational repair in Schizosaccharomyces pombe].

Repair of DNA double-strand break (DSB) is an evolutionary conserved Rad51-mediated mechanism. In yeasts, Rad51 paralogs, Saccharomyces cerevisiae Rad55-Rad57 and Schizosaccharomyces pombe Rhp55-Rhp57 are mediators of the nucleoprotein Rad51 filament formation. As shown in this work, a novel Rad51Sp-dependent pathway of DSB repair acts in S. pombe parallel to the pathway mediated by Rad51 paralogs. A new gene dds20+ that controls this pathway was identified. The overexpression of dds20+ partially suppresses defects of mutant rhp55Δ in DNA repair. Cells of dds20Δ manifest hypersensitivity to a variety of genotoxins. Epistatic analysis revealed that dds20+ is a gene of the recombinational repair group. The role of Dds20 in repair of spontaneous damages occurring in the process of replication and mating-type switching remains unclear. The results obtained suggest that Dds20 has functions beyond the mitotic S phase. The Dds20 protein physically interacts with Rhp51(Rad51Sp). Dds20 is assumed to operate at early recombinational stages and to play a specific role in the Rad51 protein filament assembly differing from that of Rad51 paralogs.

The role of recombinational repair proteins in mating type switching in fission yeast cells

DNA double-strand breaks (DSBs) occur after exposing cells to ionizing radiation or under the action of various antitumor antibiotics. They can be also generated in the course cell processes, such as meiosis and mating type switching in yeast. The most preferential mechanism for the correction of DNA DSB in yeasts is recombinational repair controlled by RAD52 group genes. The role of recombinational repair in mating type switching of fission yeast cells was examined on the example of genes of this group, rhp51+ and rhp55+. We constructed homothallic strains of genotypes h90rhp51 and h90rhp55, and found that mutant cells yielded colonies with the mottled phenotype. In addition, h90 cells with deletions in these genes were shown to segregate heterothallic iodine-negative colonies h− and h+. The genome region, responsible for the switching process in these segregants, was analyzed by DNA hybridization. As shown in this analysis, h+ segregants had the h+N or h90 configuration of the mat region, whereas h−, the h90 configuration. Segregants h+N contained DNA duplication in the mat region. DNA rearrangements were not detected at the mating type locus, but the level of DNA DSB formation was drastically decreased in these segregants. Thus, our results show that genes rhp51+ and rhp55+ are involved not only in the repair of induced DNA DSB, but also in the mechanism of mating type switching in fission yeast.

Mi-1 gene expression in tomato plants under root-knot nematode invasion and treatment with salicylic acid

The dynamics of expression of two homologous genes Mi-1.1 and Mi-1.2 in the roots of resistant and susceptible tomato plants in non-invasion conditions and during invasion with the root-knot nematode M. incognita was studied. Nematode invasion was accompanied by a significant increase in the expression level of both genes; however, the accumulation of transcripts at the early stages of nematode invasion in the penetration of nematode juveniles to the roots was observed only in plants that contained the Mi-1.2 gene, which explains the resistance of tomatoes to this root-knot nematode, caused by only this gene. We reveal a change in the Mi-1 gene activity under exogenous salicylic acid treatment, which contributed to the formation of induced resistance to root-knot nematode in the susceptible plants.

[Recombinational repair in Schizosaccharomyces pombe: the role of mediator proteins].

Repair of double-strand breaks (DSBs), which arise in DNA spontaneously or under the influence of external factors, is critical for cell survival. The evolutionarily conserved mechanism of error-free recombinational repair plays a major role in maintaining the genome integrity and has a number of similarities between lower eukaryotes and vertebrates. The review considers the currently available data on the mechanism of recombinational DSB repair in the fission yeast Schizosaccharomyces pombe and its differences from the corresponding mechanisms of Saccharomyces cerevisiae and higher eukaryotes.

Mapping the interaction site between recombination proteins in yeast cells

Chemical instability of DNA and the involvement of cellular metabolism in its exchange determine the high level of induced and spontaneous DNA lesions [1]. Unrepaired breaks in DNA may lead to chromo somal aberrations, mutagenesis, carcinogenesis, and cell death. During evolution, eukaryotic organisms developed mechanisms that allow them to retain genome stability and prevent accumulation of DNA lesions, including the mechanisms of the cell cycle control and DNA repair [2]. Recombinational DNA repair is the only errorless mechanism of correction of double stranded DNA breaks, because it uses infor mation of a homologous chromosome or a sister chro matid. The key stage of recombinational DNA repair in eukaryotes is the formation of a nucleoprotein fila ment by the Rad51 protein, a homologue of Escheri chia coli RecA, for subsequent strand exchange. In dividing yeast, paralogs Rad51, Rhp55, and Rhp57, as well as the heterodimer Sfr1/Swi5, are mediators of the Rad51 filament formation [3–5]. Genetic analysis showed that mediator complexes Rhp55/Rhp57 and Sfr1/Swi5 in Schizosaccharomyces pombe function in parallel and independently of one another in Rad51 dependent recombinational repair. There are data on the presence of several mediators involved in the fila ment folding in mice [6] and chicken [7]. In higher eukaryotic cells, BRCA2 and Rad51 paralogs function in the Rad51 dependent mechanism interacting with Rad51 and are required for formation of Rad51 repair foci [8]. This suggests the possibility of BRCA2 involvement as a mediator during the formation of the Rad51 nucleoprotein filament in parallel to the effect of paralogs. DNA strand exchange strongly depends on Rad51, RPA, and ATP [9]: the absence of one of these compo nents blocks the exchange reaction even in the pres ence of mediator proteins. It was shown that, in S. pombe cells, the heterodimer Sfr1/Swi5 directly interacts through the Sfr1 subunit with Rad51, which ensures its functioning in DNA repair, meiotic recom bination, and mechanism of tolerance to UV induced DNA lesions [5, 10]. This was the first study to identify a new type of tan dem motifs termed PSA (probe Sfr1 associated), which functions as a module to interact with ñ Rad51, the key gene of DNA recombination/repair. To generate mutations K108E in PSA1 and K164E in PSA2, we used site directed mutagenesis using two pairs of DNA primers: (1) AATATACTTCTTAAGC CGTTCGAAAGCCCCTTAAGACAAACTGC and GCAGTTTGTCTTAAGGGGCTTTCGAACGGC TTAAGTATATTTTTG and (2) AAAACGGCAA AAACGACTTTTCGAGTCACCTATCTCTAATTGC and AAGGCAATTAGAGATAGGTGACTCGAA AAGTCGTTTTTGCCGTTT. DNA was isolated and sequenced by conventional methods. To construct a plasmid expressing the pep tide with PSA1 and PSA2 (71–176 aa), we used the paR31CD vector with an inducible promoter nmt1 with thiamine repression in EMM medium (81). The sensitivity of cells to methylmethane sulfonate (MMS) and camptothecin (CPT), which blocks DNA replica tion by inhibiting topoisomerase I, was determined in a spot test with sequential tenfold dilutions of cells and subsequent plating on nutrient media. For the two hybrid analysis, we used plasmids pEG202 with LexA DNA binding domain and pJG4 5 with an activatory domain. Immunoprecipitation was performed using immunoblotting and antibodies to LexA. The analysis of the Sfr1 amino acid sequence using the COILS software showed that the C terminal part of the protein includes a coiled coil domain (178– 236 aa); the search in open databases for protein Mapping the Interaction Site between Recombination Proteins in Yeast Cells

Immunization with non-toxic variants of Shiga toxin type 2 (Stx2) generates high titers of protective antibodies

23 Effective therapy of intoxications caused by the Shiga toxin type 2 Stx2 has not yet been developed. The most promising approach for prevention is the preventive immunization against Stx2, and for the treatment of acute cases it is more preferable to use protective antibodies. In this study, we obtained non toxic Stx2 variants, immunization with which causes no disease symptoms in experimental animals and generates high titers of specific antibodies that protect the animals against the toxin.

Cell phenotypes of a mutant in the gene encoding a Rad51 paralog in fission yeast

The discovery of three Rad51 paralogs in Saccharomyces cerevisiae (Rad55, Rad57, and Dmc1), four in Schizosaccharomyces pombe (Rhp55, Rhp57, Rlp1, and Dmc1), and six in human (Rad51B, Rad51C, Rad51D, Xrcc2, Xrcc3, and Dmc1) indicate the functional diversity and specialization of RecA-like proteins in the line from the lower to higher organisms. This paper reports characterization of a number of mitotic and meiotic phenotypes of the cells mutant in rlp1 gene, encoding a paralog of Rad51, in fission yeasts. No evident role of Rlp1 protein in the repair of spontaneous lesions emerging during mating type switching was found. Rlp1 does not interact physically with Dmc1. An elevated expression of rhp51 has a dominant negative effect on the cell survivability of rlp1Δ mutant exposed to a DNA-damaging agent. We assume that Rlp1 acts at the stages of recombination connected with disassembling of the nucleoprotein filament formed by Rhp51 protein.

[Dds20 operates in cds1-independent mechanism of tolerance to UV-induced DNA damage in Schizosaccharomyces pombe cells].

Repair of DNA double-stranded breaks caused by ionizing radiation or cellular metabolization, homologous recombination, is an evolutionary conserved process controlled by RAD52 group genes. Genes of recombinational repair also play a leading role in the response to DNA damage caused by UV light. Cells with deletion in gene dds20 of recombinational repair were shown to manifest hypersensitivity to the action of UV light at lowered incubation temperature. Epistatic analysis revealed that dds20+ is not a member of the NER and UVER gene groups responsible for the repair of DNA damage induced by UV light. The Dds protein has functions in the Cds1-independent mechanism of UV damage tolerance of DNA.