F. Sanger

A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase

A simple and rapid method for determining nucleotide sequences in single-stranded DNA by primed synthesis with DNA polymerase is described. It depends on the use of Escherichia coli DNA polymerase I and DNA polymerase from bacteriophage T4 under conditions of different limiting nucleoside triphosphates and concurrent fractionation of the products according to size by ionophoresis on acrylamide gels. The method was used to determine two sequences in bacteriophage φX174 DNA using the synthetic decanucleotide A-G-A-A-A-T-A-A-A-A and a restriction enzyme digestion product as primers.

Complete sequence of bovine mitochondrial dna conserved features of the mammalian mitochondrial genome

Abstract We present here the complete 16,338 nucleotide DNA sequence of the bovine mitochondrial genome. This sequence is homologous to that of the human mitochondrial genome (Anderson et al., 1981) and the genes are organized in virtually identical fashion. The bovine mitochondrial protein genes are 63 to 79% homologous to their human counterparts, and most of the nucleotide differences occur in the third positions of codons. The minimum rate of base substitution that accounts for the nucleotide differences in the codon third positions is very high: at least 6 × 10−9 changes per position per year. The bovine and human mitochondrial transfer RNA genes exhibit more interspecies variation than do their cytoplasmic counterparts, with the “TΨC” loop being the most variable part of the molecule. The bovine 12 S and 16 S ribosomal RNA genes, when compared with those from human mitochondrial DNA, show conserved features that are consistent with proposed secondary structure models for the ribosomal RNAs. Unlike the pattern of moderate-to-high homology between the bovine and human mitochondrial DNAs found over most of the genome, the DNA sequence in the bovine D-loop region is only slightly homologous to the corresponding region in the human mitochondrial genome. This region is also quite variable in length, and accounts for the bulk of the size difference between the human and bovine mitochondrial DNAs.

Nucleotide sequence of bacteriophage λ DNA

Abstract The nucleotide sequence of the DNA of bacteriophage λ has been determined using the dideoxy chain termination method in conjunction with random cloning in M13 vectors. Various methods were studied for sequencing specific regions to complete the sequence, but all were much slower than the random approach. The DNA in its circular form contains 48,502 base-pairs. Open reading frames were identified and, where possible, ascribed to genes by comparing with the previously determined genetic map. The reading frames for 46 genes were clearly identified, though in about 20 the position of the protein initiation site could not be rigorously established. Probable positions for the kil , cIII and lom genes are suggested but remain uncertain. There are about 20 other unidentified reading frames that may code for proteins. The genome is fairly compact with comparatively little non-coding DNA. In many cases the translation terminators and initiators overlap, particularly in the sequence A-T-G-A where the TGA terminates one gene and the ATG initiates the next. Such structures seem to be characterized by a purine-rich sequence, rather than by a specific “Shine and Dalgarno” sequence, before the initiator. In the whole of the left arm the codon CTA, which is normally read by a minor leucine tRNA, is absent. The distribution of other rare codons in the genes of the left arm suggests that they may have a controlling function on the relative amounts of the proteins produced.

A Two-dimensional Fractionation Procedure for Radioactive Nucleotides

A method is described for the two-dimensional fractionation of ribonuclease digests of 32P-labelled RNA. High-voltage ionophoresis is used in both dimensions. The first is on cellulose acetate at pH 3·5, the second on DEAE-paper at an acid pH. The method is capable of resolving the di- and tri- and most of the tetra-nucleotides in digests prepared by the action of ribonuclease T1 or pancreatic ribonuclease. It has been applied to the 16 s and 23 s components of ribosomal RNA which show significant quantitative differences, and to sRNA from Escherichia coli and from yeast. A method is described for the determination of the sequence of a nucleotide by partial digestion with spleen phosphodiesterase.

The sequence of 5 s ribosomal ribonucleic acid

Abstract The nucleotide sequence of the low molecular weight ribosomal RNA (5 s RNA) of Escherichia coli has been studied using 32P-labelled RNA and paper fractionation techniques. This is shown to be: pUGCCUGGCGGCCGUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGGAACUGCCAGGCAUOH. † There are two major species of 5 s RNA which differ by a base in only one position. A new two-dimensional procedure suitable for fractionating oligonucleotides up to 25 residues long is described.

N-Formyl-methionyl-S-RNA

The reaction between methionine and S-RNA of Escherichia coli has been investigated. It has been demonstrated that, after the initial attachment to its specific S-RNA, the free α-amino group of the attached methionine may become formylated.

Nucleotide sequences from the low molecular weight ribosomal RNA of Escherichia coli.

Nucleotides from a ribonuclease digest of 32 P-labelled 5 † ribosomal RNA of Escherichia coli have been studied by two-dimensional ionophoresis on modified celluloses. All the nucleotides from ribonuclease T 1 and pancreatic ribonuclease digests were separated and their structure was determined. The yields of the smaller nucleotides were reproducible and greater than 70%. 5 s RNA consists of about 115 nucleotides of which pUG is 5′-terminal and GCAU OH is 3′-terminal.

The amino acid sequence of the phosphorylation site of muscle uridine diphosphoglucose α-1,4-glucan α-4-glucosyl transferase

The amino acid sequence at the site of phosphorylation of the enzyme uridine diphosphoglucose α-1,4-glucan α-4-glucosyl transferase in rat and rabbit muscle was studied with 32 P-labelled ATP using radiochemical techniques. The hexapeptide sequence was shown to be Arg Lys } − Glu − Ile − Ser ‐ P − Val − Arg . This is very similar to, or identical with, the sequence in rabbit muscle phosphoryl-ase a , suggesting that the two proteins are probably related.

Determination of a nucleotide sequence in bacteriophage f1 DNA by primed synthesis with DNA polymerase.

Abstract A method is described for the determination of nucleotide sequences in DNA by using specific oligonucleotides as primers for copying specific regions by DNA polymerase. The method was applied to bacteriophage f1 DNA using the synthetic octanucleotide A-C-C-A-T-C-C-A as primer and a sequence (sequence A) of 81 nueleotides was determined. Synthesis was carried out in the presence of manganese and with one of the deoxyribotriphosphates (dCTP or dGTP) replaced by the corresponding ribotriphosphate so that mixed oligonucleotides were found which could be specifically split at the ribonucleotide residues by the appropriate ribonuclease or by alkali. The relative order of the digestion products was determined by fractionating the undigested oligonucleotides according to size on a two-dimensional system and digesting the isolated products. In the presence of rGTP the octanucleotide appeared to prime at a second site giving rise to a second sequence (B) besides sequence A. The complementary sequence to sequence A, which corresponds to the plus strand of f1 DNA and to the messenger RNA, contains five nonsense codons, four of which are in the same phase, and two possible initiation codons. It also contains a repetitive sequence which suggests its evolutionary origin by duplication.

Nucleotide and amino acid sequences of gene G of φX174

The nucleotide sequence of the coding region of gene G of φ X174 and the amino acid sequence of the G -coded “spike” protein of the virion have now been completed. From the 5′ A of the initiating ATG to the 3′ end of the terminator triplet, the gene consists of 528 nucleotides and codes for a protein of 175 amino acids, molecular weight 19,053.