Fabienne Remize

Characterization of the "viable but nonculturable" (VBNC) state in the wine spoilage yeast Brettanomyces.

Although the viable but not culturable (VBNC) state has been studied in detail in bacteria, it has been suggested that maintenance of viability with loss of culturability also exists in eukaryotic cells, such as in the wine spoilage yeast Brettanomyces. To provide conclusive evidence for the existence of a VBNC state in this yeast, we investigated its capacity to become viable and nonculturable after sulfite stress, and its ability to recover culturability after stressor removal. Sulfite addition induced loss of culturability but maintenance of viability. Increasing the medium pH to decrease the concentration of toxic SO(2) allowed yeast cells to become culturable again, thus demonstrating the occurrence of a VBNC state in Brettanomyces upon SO(2) exposure. Relative to culturable Brettanomyces, VBNC yeast cells were found to display a 22% decrease in size on the basis of laser granulometry. Assays for 4-ethylguaiacol and 4-ethylphenol, volatile phenols produced by Brettanomyces, indicated that spoilage compound production could persist in VBNC cells. These morphological and physiological changes in VBNC Brettanomyces were coupled to extensive protein pattern modifications, as inferred by comparative two-dimensional electrophoresis and mass spectrometric analyses. Upon identification of 53 proteins out of the 168 spots whose abundance was significantly modified in treated cells relative to control, we propose that the SO(2)-induced VBNC state in Brettanomyces is characterized by a reduced glycolytic flux coupled to changes in redox homeostatis/protein turnover-related processes. This study points out the existence of common mechanisms between yeast and bacteria upon entry to the VBNC state.

Thermophilic spore-forming bacteria isolated from spoiled canned food and their heat resistance. Results of a French ten-year survey.

Thermal processing of Low Acid Canned Foods (LACF), which are safe and shelf-stable at ambient temperature for several years, results in heat inactivation of all vegetative microorganisms and the partial or total inactivation of spores. Good Manufacturing Hygienic Practices include stability tests for managing the pathogen risk related to surviving mesophilic bacterial spores. LACF are also often submitted to additional incubation conditions, typically 55 °C for 7 days, to monitor spoilage by thermophiles. In this study we identified the bacterial species responsible for non-stability after prolonged at 55 °C of incubation of LACF from 455 samples collected from 122 French canneries over 10 years. Bacteria were identified by microsequencing or a recent developed tool for group-specific PCR detection (SporeTraQ™). A single species was identified for 93% of examined samples. Three genera were responsible for more than 80% of all non-stability cases: mostly Moorella (36%) and Geobacillus (35%), and less frequently Thermoanaerobacterium (10%). The other most frequent bacterial genera identified were Bacillus, Thermoanaerobacter, Caldanaerobius, Anoxybacillus, Paenibacillus and Clostridium. Species frequency was dependent on food category, i.e. vegetables, ready-made meals containing meat, seafood or other recipes, products containing fatty duck, and related to the intensity of the thermal treatment applied in these food categories. The spore heat resistance parameters (D or δ and z values) from 36 strains isolated in this study were determined. Taken together, our results single out the species most suitable for use as indicators for thermal process settings. This extensively-documented survey of the species that cause non-stability at 55 °C in LACF will help canneries to improve the management of microbial contamination.

Design and performance testing of a real-time PCR assay for sensitive and reliable direct quantification of Brettanomyces in wine

Because the yeast Brettanomyces produces volatile phenols and acetic acid, it is responsible for wine spoilage. The uncontrolled accumulation of these molecules in wine leads to sensorial defects that compromise wine quality. The need for a rapid, specific, sensitive and reliable method to detect this spoilage yeast has increased over the last decade. All these requirements are met by real-time PCR. We here propose improvements of existing methods to enhance the robustness of the assay. Six different protocols to isolate DNA from a wine and three PCR mix compositions were tested, and the best method was selected. Insoluble PVPP addition during DNA extraction by a classical phenol:chloroform protocol succeeded in the relief of PCR inhibitors from wine. We developed an internal control which was efficient to avoid false negative results due to decreases in the efficiency of DNA isolation and/or amplification. The method was evaluated by an intra-laboratory study for its specificity, linearity, repeatability and reproducibility. A standard curve was established from 14 different wines artificially inoculated. The quantification limit was 31 cfu/mL.

Effect of nitrogen limitation and nature of the feed upon Oenococcus oeni metabolism and extracellular protein production.

Aims:  The aim of the study was to characterize the effect of various nitrogen sources on Oenococcus oeni growth, carbon source utilization, extracellular protease activity and extracellular proteins. More generally, the goal is to understand how nitrogen‐based additives might act to enhance malolactic fermentation in wine.

Adaptation of yeasts Saccharomyces cerevisiae and Brettanomyces bruxellensis to winemaking conditions: a comparative study of stress genes expression.

Brettanomyces is the major microbial cause for wine spoilage worldwide and causes significant economic losses. Like Saccharomyces cerevisiae, it is well adapted to winemaking, but molecular pathways involved in this acclimatization are still unknown. In this work, we report a time-scale comparison between the two yeasts coping with alcoholic fermentation. Orthologs of some well-characterized stress genes of S. cerevisiae were searched by sequence alignment in the Dekkera/Brettanomyces partial genome; nine genes were finally selected on the basis on their similarity and involvement in adaptation to wine. Transcript analysis during a model grape juice fermentation indicates that a subset of genes (i.e., ATP1, ERG6, VPS34) shows peculiar expression patterns in Brettanomyces bruxellensis but also that some common regulations of stress response exist between the two yeasts, although with different timing (i.e., for MSN4, SNF1, HSP82, NTH1). This suggests that B. bruxellensis efficient survival in such challenging conditions is due to mechanisms unique to it, together with a conserved yeast stress response. This study, although limited by the poor genetic data available on B. bruxellensis, provides first insights into its gene expression remodeling in winemaking and opens new frames for further investigations.

Characterization of EprA, a major extracellular protein of Oenococcus oeni with protease activity

Extracellular proteins from Oenococcus oeni, a wine-making bacterium, were isolated during growth on media differing by their nitrogen content. Analysis by two-dimensional electrophoresis revealed a low number of protein signals. Among the main spots, one signal corresponded to a single protein, which contained a lysine repeat domain characteristic of cell-wall hydrolases. We demonstrated that this major protein, named EprA, was able to hydrolyse several proteins. The heterologous production of this protein in Escherichia coli confirmed the protease activity of EprA. With a MW of 21.3 kDa and a pI of 5.3, EprA presents optimal activity at pH 7.0 and 45 degrees C. This O. oeni protease differs from all lactic acid bacteria proteases so far identified, and thus this bacterium possesses at least three proteases for wine protein hydrolysis.

Specific identification and quantification of the spoilage microorganism Brettanomyces in wine by flow cytometry: A useful tool for winemakers

THE yeast Brettanomyces is the major microbial cause for wine spoilage worldwide and causes significant economic loss. This yeast produces from grape acid phenols, 4-ethylphenol and 4-ethylguaiacol, which confer characteristic aroma described as mousy, smoky, burnt plastic, barnyard, horse sweat, leather, and wet wool. Moreover, these yeasts are high acetic acid producers and are capable of producing a mousy taint caused by 2-acetyl-1,4,5,6-tetrahydropyridine and 2-acetyl-3,4,5,6-tetrahydropyridine. Thus, this peculiar yeast metabolism is deleterious to wine quality. The monitoring of Brettanomyces remains a problem for most wine cellars. Recently, flow cytometry (FCM) has been proposed to quantify Brettanomyces in wine (1). However, cells are dyed with fluorescein diacetate, which stained all viable wine microorganisms and thus is not specific to Brettanomyces. By contrast, methods with some specificity, which are available to identify Brettanomyces, present other disadvantages. Most of them take 1 or 2 weeks and spoilage may occur before it is noticed by the winemaker. Detection of Brettanomyces by FCM using antibodies coupled to fluorochrome could be another strategy as it has been used successfully for other microorganisms (2). However, Brettanomyces antibodies are not available. Among the many molecular methods for analyzing microorganisms, fluorescence in situ hybridization (FISH) is a widely used method for monitoring microorganisms. Indeed, the FISH method presents advantages comparing with other molecular methods. It can target DNA or RNA regions and combines a counting technique with an identification technique and FISH analyses with rRNA targeted probes are applied for the identification and quantification of microorganisms. FISH coupled with microscopy detection has been the most commonly applied technique for analysis of specific microorganisms (3). However, visual counting is difficult and time consuming. The accuracy of this quantification approach is relatively low (4) taking into account the bias associated with interobserver variability. In recent years, the combination of FISH with FCM detection (FISH-FCM) appeared to be a very high throughput method for identification and quantification of specific microorganisms (5–7). In this study, we propose a FCM-FISH method adapted to detect and enumerate Brettanomyces cells grown in red wine using specific probes modified with the fluorescent dye Alexa Fluor 488 (Molecular Probes, Eugene, OR, USA) at the 50end. Probes 26S-D.brux.1.1 (TACCGGAACGACCGCAGT), 26S-D.brux.1.2 (TGTCACAGGCCTCTACATTG), and 26SD.brux.5.1 (CTTACTCAAATCCCTCCGGT), previously designedAdvancement of Cytometry (8) and targeting the 26S rRNA gene, were used. For experiments conducted in contaminated red wine, 1.10 cells from a 72 h YPD culture were added in an adaptation medium composed of 50% YPD and 50% red wine (Burgundy Pinot noir). After 5 days at 28 C, red wine was inoculated at 10 cells/mL and incubated at 28 C for 2 days. An aliquot of 10 cells from red wine was centrifuged (9000 g, 10 min, 25 C) and rinsed twice in PBS (130 mM NaCl, 5 mM NaH2PO4, and 5 mM Na2HPO4; pH 7.4). Permeabilization treatments were conducted to increase the percentage of fluorescent Brettanomyces cells. Indeed, first

Oligopeptide assimilation and transport by Oenococcus oeni

Aims:  Oenococcus oeni is a slow‐growing wine bacterium with a low growth yield. It thrives better on complex nitrogen sources than on free amino‐acid medium. We aimed to characterize the oligopeptide use of this micro‐organism.

Contamination pathways of spore-forming bacteria in a vegetable cannery

Spoilage of low-acid canned food during prolonged storage at high temperatures is caused by heat resistant thermophilic spores of strict or facultative bacteria. Here, we performed a bacterial survey over two consecutive years on the processing line of a French company manufacturing canned mixed green peas and carrots. In total, 341 samples were collected, including raw vegetables, green peas and carrots at different steps of processing, cover brine, and process environment samples. Thermophilic and highly-heat-resistant thermophilic spores growing anaerobically were counted. During vegetable preparation, anaerobic spore counts were significantly decreased, and tended to remain unchanged further downstream in the process. Large variation of spore levels in products immediately before the sterilization process could be explained by occasionally high spore levels on surfaces and in debris of vegetable combined with long residence times in conditions suitable for growth and sporulation. Vegetable processing was also associated with an increase in the prevalence of highly-heat-resistant species, probably due to cross-contamination of peas via blanching water. Geobacillus stearothermophilus M13-PCR genotypic profiling on 112 isolates determined 23 profile-types and confirmed process-driven cross-contamination. Taken together, these findings clarify the scheme of contamination pathway by thermophilic spore-forming bacteria in a vegetable cannery.

Genotypic and phenotypic characterization of foodborne Geobacillus stearothermophilus

Geobacillus stearothermophilus is the main thermophilic spore former involved in flat sour spoilage of canned foods. Three typing methods were tested and applied to differentiate strains at intra-species level: panC sequence analysis, REP-PCR and M13-PCR. panC gene was highly conserved within the studied strains, suggesting a low intra-specific diversity. This was supported by REP-PCR primary assays and M13-PCR results. M13-PCR profile analysis succeeded in differentiating six closely related groups (at 79% threshold similarity) among 127 strains from a range of spoiled canned food products and from different canneries. Phenotypic traits were investigated among 20 selected strains representing groups and origins. Ranges of growth under different temperatures (from 40 °C to 70 °C), pH (from 5.0 to 6.5), NaCl concentrations (from 1 to 5%) and sporulation conditions poorly differed between strains, but wet heat resistance of spores showed a 20-fold variation between strains. Furthermore, in this study, strains that belonged to the same M13-PCR genetic group did not share phenotypic characteristics or common origin. The work emphasizes a low diversity within the G. stearothermophilus species but data from this study may contribute to a better control of G. stearothermophilus spoilage in canned food.