Francisco Rodríguez-Frias

Clinical outcome of acute and chronic hepatitis delta over time: a long-term follow-up study.

Summary.u2002 Long‐term changes in the frequency and outcome of hepatitis delta virus (HDV) infection have seldom been analysed. This retrospective, longitudinal study includes 398 consecutive hepatitis B surface antigen (HBsAg)‐positive patients with anti‐HDV antibodies who attended our institution between 1983 and 2008. At enrolment, 182 patients had acute and 216 chronic hepatitis. Patients were grouped into two periods. Those who attended between 1983 and 1995 and those between 1996 and 2008. The former group was significantly younger, mainly intravenous drugs users, and had a greater incidence of acute HDV and HIV and HCV coinfection. Patients with acute HBV/HDV coinfection cleared both infections in 90% of cases, while all patients with HDV superinfection evolved to chronic disease. One hundred and fifty‐eight patients with chronic HDV were followed for a median period of 158u2003months. Seventy‐two per cent of the patients remained stable, 18% had hepatic decompensation, 3% developed hepatocellular carcinoma, and 8% cleared HBsAg. Liver‐related death was observed in 13% of patients and mainly occurred in patients from the first period (Pu2003=u20030.012). These results indicate an outbreak of HDV at the end of the 1980s and the beginning of the 1990s, with a large number of acute HDV cases affecting predominately young, male intravenous drug users. Currently, patients with chronic HDV disease are older, and factors associated with worse prognosis include the presence of cirrhosis and age at the time of diagnosis.

High-Resolution Hepatitis C Virus Subtyping Using NS5B Deep Sequencing and Phylogeny, an Alternative to Current Methods

ABSTRACT Hepatitis C virus (HCV) is classified into seven major genotypes and 67 subtypes. Recent studies have shown that in HCV genotype 1-infected patients, response rates to regimens containing direct-acting antivirals (DAAs) are subtype dependent. Currently available genotyping methods have limited subtyping accuracy. We have evaluated the performance of a deep-sequencing-based HCV subtyping assay, developed for the 454/GS-Junior platform, in comparison with those of two commercial assays (Versant HCV genotype 2.0 and Abbott Real-time HCV Genotype II) and using direct NS5B sequencing as a gold standard (direct sequencing), in 114 clinical specimens previously tested by first-generation hybridization assay (82 genotype 1 and 32 with uninterpretable results). Phylogenetic analysis of deep-sequencing reads matched subtype 1 calling by population Sanger sequencing (69% 1b, 31% 1a) in 81 specimens and identified a mixed-subtype infection (1b/3a/1a) in one sample. Similarly, among the 32 previously indeterminate specimens, identical genotype and subtype results were obtained by direct and deep sequencing in all but four samples with dual infection. In contrast, both Versant HCV Genotype 2.0 and Abbott Real-time HCV Genotype II failed subtype 1 calling in 13 (16%) samples each and were unable to identify the HCV genotype and/or subtype in more than half of the non-genotype 1 samples. We concluded that deep sequencing is more efficient for HCV subtyping than currently available methods and allows qualitative identification of mixed infections and may be more helpful with respect to informing treatment strategies with new DAA-containing regimens across all HCV subtypes.

HIV, HEV and cirrhosis: evidence of a possible link from eastern Spain

The aim of the study was to assess the seroprevalence of hepatitis E virus (HEV) infection in an HIV‐infected population, as determined by HEV immunoglobulin G (IgG) antibodies (anti‐HEV).

Successful use of entecavir for a severe case of reactivation of hepatitis B virus following polychemotherapy containing rituximab

BACKGROUNDS/AIMSnHepatitis B virus (HBV) reactivation following treatment with rituximab has been reported in patients with either HBsAg-positive, or HBsAg-negative and anti-HBc positive infection. Patients with severe reactivation often have a fatal outcome despite treatment with lamivudine. The use of entecavir has not been reported in patients with severe HBV reactivation.nnnMETHODSnWe present a case of a HBsAg-negative patient diagnosed with chronic lymphocytic leukemia who received a chemotherapeutic regimen that included rituximab, who subsequently presented with severe HBV reactivation with ascites, jaundice and coagulopathy and was treated with entecavir. A review of the literature and underlying HBV associated mutations are discussed.nnnRESULTSnEntecavir produced a rapid and sustained suppression of HBV that was associated with rapid clinical improvement without any side effects.nnnCONCLUSIONnEntecavir is an efficacious and safe treatment for severe HBV reactivation.

IL28B genetic variation and hepatitis C virus–specific CD4+ T-cell responses in anti-HCV-positive blood donors

Summary.u2002 Epidemiological, viral and host factors are associated with the outcome of hepatitis C virus (HCV) infection, and strong host immune responses against HCV favour viral clearance. Recently, genome‐wide association studies have shown a strong correlation between single‐nucleotide polymorphisms (SNPs) near the interleukin‐28B (IL28B) gene and spontaneous or treatment‐induced HCV clearance. We have investigated whether protective IL28B genetic variants are associated with HCV‐specific T‐cell responses among Spanish blood donors. The rs12979860 IL28B haplotype was determined in 69 anti‐HCV‐positive blood donors (21 HCV RNA negative and 48 HCV RNA positive) and 30 seronegative donors. In all cases, HCV‐specific CD4+ T‐cell responses to HCV recombinant proteins (core, NS3 and NS3 helicase) were assessed by ex vivo interferon‐γ ELISpot assay. The rs12979860‐CC genotype was highly overrepresented in donors with spontaneous HCV clearance when compared to those with chronic infection (76.2%vs 29.2%, Pu2003<u20030.001; odds ratio, 7.77; 95% confidence interval, 2.4–25.3, Pu2003<u20030.001). HCV‐specific CD4+ T‐cell responses were detected in 16 (76.2%) spontaneous resolvers especially towards nonstructural proteins, but with no correlation with IL28B genotype. Chronic individuals had a significantly lower overall T‐cell response again irrespective of IL28B genotype. When spontaneous resolvers and chronic individuals were stratified according to their IL28B genotype, significantly stronger T‐cell responses were only observed among those with non‐CC haplotypes. Although the protective rs12979860 IL28B CC genotype is associated with spontaneous HCV clearance, stronger CD4+ T‐cell responses towards NS3 were only evident among those with non‐CC haplotypes.

Non-A, Non-B, Non-C, Non-E Acute Hepatitis: Does it Really Exist?

Consecutive serum samples from 341 patients with acute hepatitis were tested for IgM antibodies to hepatitis A virus (HAV), core antigen of hepatitis B virus (HBV), and for hepatitis B surface antigen (HBsAg). Anti-HCV was determined using a second-generation EIA. In selected samples, antibodies to hepatitis E virus (HEV) were determined by EIA and HCV-RNA was detected by polymerase chain reaction (PCR). One-hundred fourteen (33.2%) cases were due to HAV, 68 (20%) to HBV, 21 (6%) to hepatitis D virus (HDV) and 74 (21.8%) to HCV infection. Of the 74 patients with HCV infection, 48 (65%) were initially anti-HCV positive and 26 (35%) seroconverted to anti-HCV during the follow-up. No case of hepatitis E virus infection was detected. The remaining 64 cases were negative to all acute serological markers and were classified as non-A, non-B, non-C, non-E hepatitis. HCV was implicated in 65/119 (54.6%) of intravenoos drug user cases but in only 9/199 (4.5%) of the sporadic cases (P < 0.01). Progression to chronic hepatitis was observed more frequently in anti-HCV-positive than in antibody-negative cases (42/70 or 60% vs 3/52 or 5.5%) (P < 0.01). These results show that 20% of acute hepatitis cases cannot be etiologically classified despite the use of all available serological markers, suggesting the existence of another virus which is able to produce acute hepatitis. The disease produced by this virus is generally benign and leads to resolution.

Correction for Quer at al., High-Resolution Hepatitis C Virus Subtyping Using NS5B Deep Sequencing and Phylogeny, an Alternative to Current Methods

Volume 53, no. 1, p. [219–226][1], 2015. Page 221, Table 1: The sequence for primer 13N5Bo8254 should read “GTTGTAAAACGACGGCCAGT CNTAYGAYACCMGNTGYTTTGACTC .”nn [1]: /lookup/doi/10.1128/JCM.02093-14

P0624 : Acute viral hepatitis: Epidemiological change during the last 25 years in Spain

MELD score (AUC: 0.81) and better than MELD-NA (AUC: 0.78) and CP (AUC: 0.74) scores. In contrast, HMGB1 had no prognostic value (p =0.681), neither in cirrhotic nor in non-cirrhotic HBVACLF patients. In order to accurately predict the clinical prognosis of HBV-ACLF patients, we test the MELD-65 index [MELD-65 = 0.000372×M65-antigen (U/L) + 0.3432×MELD score − 11.17] established by logistic regression analysis with MELD and M65antigen remaining in the model. The new M65-based MELD score (AUC: 0.92, 95%CI 0.81 to 0.98, youden index: 0.71) provided significantly better predictive values in HBV-ACLF than MELD (AUC: 0.81, youden index: 0.6, P value vs MELD-65, P = 0.03), MELD-NA (AUC: 0.77, youden index: 0.45, P value vs MELD-65, P = 0.01) and CP (AUC: 74, youden index: 0.37, P value vs MELD-65, P = 0.02) scores. Conclusions: The MELD-65 index, a combination of MELD score and M65-antigen, has superior predictive accuracy to MELD, MELD-NA and CTP scores for the prognosis of HBV-ACLF patients from Asiapacific. Further prospective clinical studies are warranted to validate its role in predicting ACLF patients with other etiologies.