L Viladomiu

Paracentesis with Intravenous Infusion of Albumin as Compared with Peritoneovenous Shunting in Cirrhosis with Refractory Ascites

BACKGROUND There is no satisfactory treatment for refractory ascites in patients with cirrhosis. Both peritoneovenous shunts and paracentesis have been used, but there is uncertainty about their relative merits. METHODS We studied 89 patients with cirrhosis and refractory ascites who were randomly assigned to receive either repeated large-volume paracentesis plus intravenous albumin or a LeVeen peritoneovenous shunt. Patients in the paracentesis group in whom recurrent tense ascites developed during follow-up were treated with paracentesis, and those in the peritoneovenous-shunt group with diuretic agents or by the insertion of a new shunt if there was shunt obstruction. RESULTS During the first hospitalization, ascites was removed in all 41 patients in the paracentesis group and in 44 of the 48 patients in the peritoneovenous-shunt group. The mean (+/- SD) duration of hospitalization in the two groups was 11 +/- 5 and 19 +/- 9 days, respectively (P less than 0.01). There were no significant differences in the number of patients who had complications or died. During follow-up, 37 patients in each group were hospitalized again. In the paracentesis group, the number of rehospitalizations for any reason (174 vs. 97 in the peritoneovenous-shunt group) or for ascites (125 vs. 38) was significantly higher, and the median time to a first readmission for any reason (1 +/- 1 vs. 2 +/- 2 months) or for ascites (2 +/- 2 vs. 8 +/- 17 months) was significantly shorter than in the peritoneovenous-shunt group. The total times in the hospital during follow-up, however, were similar in the two groups (48 +/- 49 and 44 +/- 39 days, respectively). Three patients had obstructions of their peritoneovenous shunts during their first hospitalizations, and 15 patients had a total of 20 obstructions during follow-up. Survival was similar in both groups. CONCLUSIONS The LeVeen shunt and paracentesis are equally effective in relieving refractory ascites. The former may provide better long-term control of ascites, but shunt occlusion is common and survival is not improved.

High-Resolution Hepatitis C Virus Subtyping Using NS5B Deep Sequencing and Phylogeny, an Alternative to Current Methods

ABSTRACT Hepatitis C virus (HCV) is classified into seven major genotypes and 67 subtypes. Recent studies have shown that in HCV genotype 1-infected patients, response rates to regimens containing direct-acting antivirals (DAAs) are subtype dependent. Currently available genotyping methods have limited subtyping accuracy. We have evaluated the performance of a deep-sequencing-based HCV subtyping assay, developed for the 454/GS-Junior platform, in comparison with those of two commercial assays (Versant HCV genotype 2.0 and Abbott Real-time HCV Genotype II) and using direct NS5B sequencing as a gold standard (direct sequencing), in 114 clinical specimens previously tested by first-generation hybridization assay (82 genotype 1 and 32 with uninterpretable results). Phylogenetic analysis of deep-sequencing reads matched subtype 1 calling by population Sanger sequencing (69% 1b, 31% 1a) in 81 specimens and identified a mixed-subtype infection (1b/3a/1a) in one sample. Similarly, among the 32 previously indeterminate specimens, identical genotype and subtype results were obtained by direct and deep sequencing in all but four samples with dual infection. In contrast, both Versant HCV Genotype 2.0 and Abbott Real-time HCV Genotype II failed subtype 1 calling in 13 (16%) samples each and were unable to identify the HCV genotype and/or subtype in more than half of the non-genotype 1 samples. We concluded that deep sequencing is more efficient for HCV subtyping than currently available methods and allows qualitative identification of mixed infections and may be more helpful with respect to informing treatment strategies with new DAA-containing regimens across all HCV subtypes.

Utility of early testing for HCV viremia as predictive factor of sustained response during interferon or interferon plus ribavirin treatment

BACKGROUND/AIM To evaluate the utility of early testing for hepatitis C viremia as a predictor of treatment outcome during interferon or combination therapy. METHODS We studied 184 patients with chronic hepatitis C who received interferon and were monitored for HCV RNA. Sixty-two patients received interferon alone for 12 months and 122 patients, who were still HCV RNA positive at 2 months, received an additional 12-month course of interferon and ribavirin combination therapy. RESULTS Using this strategy, sustained response occurred in a total of 34 patients (18.5%). Independent variables associated with sustained response were HCV genotype (p=0.06), viral load < or = 5.1 logs/ml (p= 0.005) and negative HCV RNA at 1 month (p<0.0001) in the interferon group, and female sex (p=0.04), genotype (p=0.03), viral load < or = 5.5 logs/ml (p=0.01), normal ALT (p=0.001) and decline in viral load > or = 1.2 logs/ml after 2 months of interferon monotherapy (p<0.001) and negative viremia at 5 months of ribavirin onset (p<0.0001) in the combination therapy group. Persistence of viremia at 1 month of interferon monotherapy and at 5 months of combination therapy were the strongest predictors of non-response (negative predictive value of 100% and 99%, respectively). CONCLUSIONS Qualitative assessment of HCV RNA during treatment is the strongest predictor of sustained response during interferon or combination therapy for chronic hepatitis C.

Evaluation of hepatitis C virus RNA RT/PCR qualitative and quantitative second generation assays

Hepatitis C virus (HCV) RNA qualitative and quantitative second generation assays (Amplicor HCV v2.0 and Amplicor HCV Monitor v2.0, respectively) were evaluated by testing serum samples from 132 blood donors anti-HCV positive HCV RNA negative by first generation qualitative assay and 326 viremic patients. An HCV RNA transcript was synthesized and ten-fold dilutions were used to assess sensitivity. Second generation assays were one log more sensitive than their respective first generation tests (10(2) copies per ml vs. 10(3) for the qualitative tests; 10(3) copies per ml vs. 10(4) for the quantitative tests). From the 132 anti-HCV positive RNA negative subjects, 6 (5%) were positive by Amplicor v2.0. Quantification figures by Monitor v2.0 were similar in genotypes 1, 2 and 3, whereas Monitor 1.0 values were higher in genotype 1 than in genotype 2 or 3. In 114 patients, branched-DNA v2.0 obtained higher values than Monitor v2.0 and Monitor v1.0 (6.6+/-0.6 log RNA copies per ml, 6.4+/-0.6, and 5.3+/-0.7, respectively, P<0.001). HCV RNA qualitative and quantitative second generation assays are more sensitive and genotype independent than first generation assays.

Evaluation of anti-HCV positive donors identified during routine screening

Of 30,231 donors tested, 368 (1.2%) were anti-HCV positive. Of these, 254 have been evaluated, with the following results: only 25% have a history of parenteral risk, seroprevalence increases with age and approximately 80% of those that are anti-HCV positive in our population are probably infected with HCV. In addition, an unexpectedly large number of these persons have chronic and/or severe liver disease and will require combined diagnostic approaches for accurate evaluation.

Correction for Quer at al., High-Resolution Hepatitis C Virus Subtyping Using NS5B Deep Sequencing and Phylogeny, an Alternative to Current Methods

Volume 53, no. 1, p. [219–226][1], 2015. Page 221, Table 1: The sequence for primer 13N5Bo8254 should read “GTTGTAAAACGACGGCCAGT CNTAYGAYACCMGNTGYTTTGACTC .” [1]: /lookup/doi/10.1128/JCM.02093-14