Gary P. Jeffrey

Validation of the FibroTest Biochemical Markers Score in Assessing Liver Fibrosis in Hepatitis C Patients

BACKGROUND Determining the stage of fibrosis by liver biopsy is important in managing patients with hepatitis C virus infection. We investigated the predictive value of the proprietary FibroTest score to accurately identify significant fibrosis in Australian hepatitis C patients. METHODS Serum obtained from 125 confirmed hepatitis C patients before antiviral therapy was analyzed for haptoglobin, alpha(2)-macroglobulin, apolipoprotein A1, bilirubin, and gamma-glutamyltransferase activity, and the FibroTest score was computed. Liver fibrosis pathology was staged according to a defined system on a scale of F0 to F4. We used predictive values and a ROC curve to assess the accuracy of FibroTest scores. RESULTS The prevalence of significant fibrosis defined by liver biopsy was 0.38. The most useful single test for predicting significant fibrosis was serum alpha(2)-macroglobulin (cutoff value, 2.52 g/L; sensitivity, 75%; specificity, 67%). The negative predictive value of a FibroTest score <0.1 was 85%, and the positive predictive value of a score >0.6 was 78%. Although 33 of the 125 patients had FibroTest scores <0.1 and were therefore deemed unlikely to have fibrosis, 6 (18%) had significant fibrosis. Conversely, of the 24 patients with scores >0.6 who were likely to have significant fibrosis, 5 (21%) had mild fibrosis. Of the 125 patients in the cohort, 57 (46%) could have avoided liver biopsy, but discrepant results were recorded in 11 of those 57 (19%). CONCLUSION The FibroTest score could not accurately predict the presence or absence of significant liver fibrosis.

Polymorphism in intron 4 of HFE may cause overestimation of C282Y homozygote prevalence in haemochromatosis

Mutations of HFE are responsible for haemochromatosis, and a 5474A mutation (g.5474GA, C282Y) was found to be present in 83−100% of typical patients with this disorder1, 2, 3, 4. Previous studies have determined the prevalence of haemochromatosis by restriction endonuclease digestion or oligonucleotide ligation assay (OLA) of amplified genomic DNA obtained by PCR using sense primer 5´−TGGCAAGGGTAAACAGATCC−3´ and antisense primer 5´−CTCAGGCACTCCTCAACC−3´ (Fig. 1; ref. 4). A restriction endonuclease digestion assay identified 31 putative 5474A homozygotes from 5,211 individuals tested in a population-screening study of voluntary blood donors. When we validated the assay by genomic DNA sequence analysis, only 16 individuals were confirmed to be 5474A homozygotes and the remaining 15 were heterozygous for this mutation. Each of the 5474A heterozygotes was also heterozygous for a previously unrecognized 5569G/A single-nucleotide polymorphism located in the binding region of the antisense primer. We developed a new antisense primer that excluded the site of the new polymorphism (5´−TACCTCCTCAGGCACTCCTC−3´), and confirmed the 15 putative homozygotes to be 5474A heterozygotes using restriction endonuclease digestion (Fig. 2). The new polymorphism was present in 21% of 113 normal patients, corresponding to an allele frequency of 0.106 in this sample. Hill and Robertsons maximum likelihood estimate of linkage disequilibrium D (ref. 5) was 0.71 (P<0.005), confirming the presence of moderate to strong linkage disequilibrium between the 2 variant sites. It is unlikely that the 5569A polymorphism has functional significance, because it is found within intron 4 and does not disrupt a splice-site consensus sequence. Moreover, all 5474A/5569A compound heterozygotes had a transferrin saturation in the normal range (mean 31%, range 20−40%). In our population study, the prevalence of haemochromatosis was reduced from 1 in 168 to 1 in 327 by the use of the new primers. These results have major public health implications regarding the use of population screening for haemochromatosis6, 7. Individuals previously considered to be non-expressing 5474A homozygotes on the basis of a PCR-based restriction endonuclease digestion assay using the original Feder et al. primers require confirmatory testing.

Hepatitis C virus drug resistance and immune-driven adaptations: Relevance to new antiviral therapy†

The efficacy of specifically targeted anti‐viral therapy for hepatitis C virus (HCV) (STAT‐C), including HCV protease and polymerase inhibitors, is limited by the presence of drug‐specific viral resistance mutations within the targeted proteins. Genetic diversity within these viral proteins also evolves under selective pressures provided by host human leukocyte antigen (HLA)‐restricted immune responses, which may therefore influence STAT‐C treatment response. Here, the prevalence of drug resistance mutations relevant to 27 developmental STAT‐C drugs, and the potential for drug and immune selective pressures to intersect at sites along the HCV genome, is explored. HCV nonstructural (NS) 3 protease or NS5B polymerase sequences and HLA assignment were obtained from study populations from Australia, Switzerland, and the United Kingdom. Four hundred five treatment‐naïve individuals with chronic HCV infection were considered (259 genotype 1, 146 genotype 3), of which 38.5% were coinfected with human immunodeficiency virus (HIV). We identified preexisting STAT‐C drug resistance mutations in sequences from this large cohort. The frequency of the variations varied according to individual STAT‐C drug and HCV genotype/subtype. Of individuals infected with subtype 1a, 21.5% exhibited genetic variation at a known drug resistance site. Furthermore, we identified areas in HCV protease and polymerase that are under both potential HLA‐driven pressure and therapy selection and identified six HLA‐associated polymorphisms (P ≤ 0.05) at known drug resistance sites. Conclusion: Drug and host immune responses are likely to provide powerful selection forces that shape HCV genetic diversity and replication dynamics. Consideration of HCV viral adaptation in terms of drug resistance as well as host “immune resistance” in the STAT‐C treatment era could provide important information toward an optimized and individualized therapy for chronic hepatitis C. (HEPATOLOGY 2009.)

Evidence of Viral Adaptation to HLA Class I-Restricted Immune Pressure in Chronic Hepatitis C Virus Infection

ABSTRACT Cellular immune responses are an important correlate of hepatitis C virus (HCV) infection outcome. These responses are governed by the hosts human leukocyte antigen (HLA) type, and HLA-restricted viral escape mutants are a critical aspect of this host-virus interaction. We examined the driving forces of HCV evolution by characterizing the in vivo selective pressure(s) exerted on single amino acid residues within nonstructural protein 3 (NS3) by the HLA types present in two host populations. Associations between polymorphisms within NS3 and HLA class I alleles were assessed in 118 individuals from Western Australia and Switzerland with chronic hepatitis C infection, of whom 82 (69%) were coinfected with human immunodeficiency virus. The levels and locations of amino acid polymorphisms exhibited within NS3 were remarkably similar between the two cohorts and revealed regions under functional constraint and selective pressures. We identified specific HCV mutations within and flanking published epitopes with the correct HLA restriction and predicted escaped amino acid. Additional HLA-restricted mutations were identified that mark putative epitopes targeted by cell-mediated immune responses. This analysis of host-virus interaction reveals evidence of HCV adaptation to HLA class I-restricted immune pressure and identifies in vivo targets of cellular immune responses at the population level.

Complex non-invasive fibrosis models are more accurate than simple models in non-alcoholic fatty liver disease

Background and Aim:  Significant hepatic fibrosis is prognostic of liver morbidity and mortality in non‐alcoholic fatty liver disease (NAFLD); however, it remains unclear whether non‐invasive fibrosis models can determine this end‐point. We therefore compared the accuracy of simple bedside versus complex fibrosis models across a range of fibrosis in a multi‐centre NAFLD cohort.

Divergent adaptation of hepatitis C virus genotypes 1 and 3 to human leukocyte antigen–restricted immune pressure

Many hepatitis C virus (HCV) infections worldwide are with the genotype 1 and 3 strains of the virus. Cellular immune responses are known to be important in the containment of HCV genotype 1 infection, and many genotype 1 T cell targets (epitopes) that are presented by host human leukocyte antigens (HLAs) have been identified. In contrast, there is almost no information known about the equivalent responses to genotype 3. Immune escape mechanisms used by HCV include the evolution of viral polymorphisms (adaptations) that abrogate this host–viral interaction. Evidence of HCV adaptation to HLA‐restricted immune pressure on HCV can be observed at the population level as viral polymorphisms associated with specific HLA types. To evaluate the escape patterns of HCV genotypes 1 and 3, we assessed the associations between viral polymorphisms and specific HLA types from 187 individuals with genotype 1a and 136 individuals with genotype 3a infection. We identified 51 HLA‐associated viral polymorphisms (32 for genotype 1a and 19 for genotype 3a). Of these putative viral adaptation sites, six fell within previously published epitopes. Only two HLA‐associated viral polymorphisms were common to both genotypes. In the remaining sites with HLA‐associated polymorphisms, there was either complete conservation or no significant HLA association with viral polymorphism in the alternative genotype. This study also highlights the diverse mechanisms by which viral evasion of immune responses may be achieved and the role of genotype variation in these processes. Conclusion: There is little overlap in HLA‐associated polymorphisms in the nonstructural proteins of HCV for the two genotypes, implying differences in the cellular immune pressures acting on these viruses and different escape profiles. These findings have implications for future therapeutic strategies to combat HCV infection, including vaccine design. (HEPATOLOGY 2009.)

Patient and graft survival after liver transplantation for hereditary hemochromatosis: Implications for pathogenesis

The clinical outcome of patients who have undergone liver transplantation for hereditary hemochromatosis (HH) or who have received iron‐loaded donor grafts is unclear. We reviewed 3,600 adult primary orthotopic liver transplants and assessed the outcomes in 22 patients with HH. We also evaluated graft function and iron mobilization in 12 recipients of iron‐loaded donor grafts. All 22 subjects who received liver transplants for HH were male; 13 had other risk factors for liver disease. HH patients had comparatively poor outcomes following transplantation: survival at 1, 3, and 5 years posttransplantation were 72%, 62%, and 55%, respectively. Recurrent hepatocellular cancer was the most common cause of death. There was no convincing evidence of reaccumulation of iron in the grafted liver in HH; however, 1 subject demonstrated increased serum ferritin concentration and grade 2 hepatic siderosis. Liver iron stores were slow to mobilize in 7 of the 12 recipients of iron‐loaded grafts. These recipients had appropriate early graft function, but 2 patients with heavy iron loading and increased hepatic iron developed hepatic fibrosis. In conclusion, (1) HH is an uncommon indication for liver transplantation, and the majority of patients requiring transplantation had other risk factors for chronic liver disease; (2) reaccumulation of liver iron in HH patients is very unusual, but increased iron stores may be slow to mobilize in normal recipients of iron‐loaded grafts, potentially compromising late graft function; (3) post‐liver transplant survival is reduced in HH, and affected patients require careful clinical evaluation of perioperative and postoperative risk factors. Our data suggest that iron excess in HH does not wholly depend on intestinal iron absorption but is also influenced by liver factors that moderate iron metabolism. (HEPATOLOGY 2004;39:1655–1662.)

Hepatitis C virus eradication in intravenous drug users maintained with subcutaneous naltrexone implants

The effectiveness of HCV antiviral therapy in patients who have undergone recent drug dependency treatment and continue to inject drugs sporadically is presently not clear. Patients attending a community‐based drug rehabilitation and naltrexone implant clinic from October 2002 until March 2005 were screened for HCV infection and if positive offered further assessment and treatment with interferon and ribavirin therapy. The first 50 patients to commence HCV therapy and complete at least 6 months follow‐up were prospectively studied. ETR response (HCV PCR negative) was 34/50 (68%) and SVR 6 months post‐treatment was 31/50 (62%). Viral eradication was maintained in those 22 patients that have had 12 months or more post‐treatment follow‐up. Eleven (22%) patients stopped therapy early due to side effects or poor compliance. Only two patients with an ETR likely reinfected due to unsafe injection practices. One was re‐treated and achieved an SVR. Of the patients achieving a 6‐month SVR, 17 of 31 patients reported no further IDU and 13 of 31 patients occasional IDU during treatment and this was maintained after HCV treatment cessation. 46% of patients received antidepressant and/or antipsychotic medication during treatment. Conclusion: This study of HCV treatment in a community‐based subcutaneous naltrexone implant clinic found antiviral therapy resulted in a 62% SVR. This result is comparable to that reported in hospital‐based clinics in non‐IDU patients. The side effect profile and compliance was also similar. HCV antiviral therapy should be offered to this large and currently under treated group. (HEPATOLOGY 2007;45:111–117.)

Carbamazepine Hepatotoxicity: Another Cause of the Vanishing Bile Duct Syndrome

Serious carbamazepine hepatotoxicity is being recognized more frequently and is usually manifest as an acute granulomatous hepatitis that is self-limiting if the drug is withdrawn. The case of a 59-year-old man who developed the vanishing bile duct syndrome after 2 months of treatment with carbamazepine for glossopharyngeal neuralgia is reported. The characteristic histological features of this syndrome may also be seen in primary biliary cirrhosis, primary sclerosing cholangitis, graft-vs.-host disease after allogeneic bone marrow transplantation, chronic liver allograft rejection, and other drug reactions. The progress of this patient to date suggests that irreversible liver injury resulting in chronic liver disease is likely, in keeping with the clinical course of the vanishing bile duct syndrome in most cases.

The evolving epidemiology of hepatocellular carcinoma: A global perspective

Primary liver cancer, the majority of which are hepatocellular carcinomas, is now the second leading cause of cancer death worldwide. Hepatocellular carcinoma is a unique cancer that typically arises in the setting of chronic liver disease at a rate dependent upon the complex interplay between the host, disease and environmental factors. Infection with chronic hepatitis B or C virus is currently the dominant risk factor worldwide. However, changing lifestyle and environmental factors in western countries plus rising neonatal hepatitis B vaccination rates and decreasing exposure to dietary aflatoxins in developing countries are driving an evolution of the epidemiology of this cancer. An understanding of this change is crucial in combating the rising incidence currently being seen in western regions and will underpin the efforts to reduce the mortality rates associated with this cancer.