Ghazala Kaukab Raja

Genetic Associations of Psoriasis in a Pakistani Population

Genetic predisposition to psoriasis, an inflammatory skin disease affecting 0·2–4% of the world population, is well established. Thus far, 41 psoriasis susceptibility loci reach genome‐wide significance (P ≤ 5 × 10−8). Identification of genetic susceptibility loci in diverse populations will help understand the underlying biology of psoriasis susceptibility.

Reduction of ochratoxin A in broiler serum and tissues by Trichosporon mycotoxinivorans

The present study was planned to evaluate the possible transmission of ochratoxin A (OTA) in serum and targeted organs of broilers fed on two levels (500 and 1000 ppb) this toxin in the presence or absence of a toxin deactivator (containing a mycotoxin deactivating yeast Trichosporon mycotoxinivorans) at two inclusion levels (1 and 2 kg/ton of feed) to 270 day-old broiler chicks divided into nine groups (A-I) over a 42 days period. Serum samples were collected at 14, 28 and 42nd day of experiment, whereas, liver and kidney tissues were obtained from broilers slaughtered at 42nd day of experiment. The highest OTA levels were detected in serum, livers and kidneys of OTA treated groups without supplementation of toxin deactivator (groups D and G) at day 42 of experiment, while the residues were significantly (P<0.01) lower in treatment groups (F and I) supplemented with toxin deactivator at 2 kg/ton of feed. The order of OTA level was serum>kidneys>liver.

A Single SNP Surrogate for Genotyping HLA-C∗06: 02 in Diverse Populations

Over forty-one genetic susceptibility loci of genome-wide significance (P < 5 × 10−8) are known for psoriasis, a common complex genetic disease characterized by epidermal hyperproliferation and cutaneous inflammation. The most strongly associated of these loci maps to the HLA-C gene in the major histocompatibility complex (MHC) on chromosome 6p21.3 (Tsoi et al., 2012; Zhang et al., 2009). Recent fine mapping studies have identified multiple independent association signals in the MHC, and the strongest signal is associated with HLA-C*06:02 (previous designations: HLA-Cw6, HLA-Cw*0602) or SNPs that are near-perfect surrogates for this allele (Das et al., 2014; Feng et al., 2009; Knight et al., 2012; Okada et al., 2014). HLA-C*06:02 has been known to be psoriasis-associated since the 1970s, and most world populations studied have shown strong evidence of association (Okada et al., 2014; Shaiq et al., 2013; Stuart et al., 2010; Zhang et al., 2009). Yet, it is difficult to perform a routine affordable laboratory test for the presence or absence of HLA-C* 06:02 because DNA-based testing is complicated both by the high degree of polymorphism of HLA-C (2375 alleles encoding 1677 protein variations; July 2014 release of IMGT/HLA database) (Robinson et al., 2013) and by the sequence similarity of HLA-C* 06:02 to other HLA-C as well as HLA-A and HLA-B alleles. We previously used a 7- SNP genotyping system to unambiguously define HLA-C*06:02 and several other HLA-C alleles (Nair et al., 2006). Others have used allele-specific amplification followed by electrophoresis (Bunce et al., 1995), PCR amplification followed by restriction enzyme digestion (Tazi Ahnini et al., 1999), a combination of four surrogate SNPs that are amenable to Taqman genotyping (Nikamo and Stahle, 2012), and a 3-SNP haplotype (rs1576-rs130076-rs2523619) known to be in strong linkage disequilibrium (LD) with HLA-C*06:02 (Huffmeier et al., 2009). Imputation of classical HLA alleles including HLA-C*06:02 is another widely-used approach (Jia et al., 2013; Leslie et al., 2008), but this requires high density genotyping of the sample for SNPs throughout the MHC region, as well as a reference panel drawn from the same population that has been typed for both classical HLA genes and a high density of MHC SNPs. During the course of our genome-wide association studies of psoriasis and fine mapping of MHC loci, we discovered that the A allele of SNP rs4406273, located 28.73 kb centromeric of HLA-C, is a near-perfect surrogate for HLA-C*06:02 allele. Notably, this SNP was the most strongly associated variant in the largest genome-wide association study of psoriasis to date (Tsoi et al., 2012). Since rs4406273 is only 3 bases away from another SNP, it is not amenable to the commonly-used Taqman (Applied Biosystems, Foster City, CA) genotyping assay design. However, it can be genotyped using single base extension methods. In this study, we examined the adequacy of genotyping rs4406273 as a single marker surrogate for HLA-C*06:02 in three different populations–5,009 European-ancestry samples collected in Michigan, 835 samples from Pakistan, and 307 samples from Thailand. All DNA samples used in this study were prepared from peripheral blood obtained following protocols approved by the ethics boards of participating institutions and adhering to the Declaration of Helsinki principles. Written informed consent was obtained from all study participants. Reference HLA-C*06:02 genotypes were generated by our previously reported 7-marker method (Nair et al., 2006), and rs4406273 was genotyped using the single base extension method implemented in the Applied Biosystems Snapshot Assay. Briefly, this assay involved (1) amplification of a 237 bp segment of DNA encompassing rs4406273 using PCR primers CTGGAAAGGGTGAGGAAACA and TGACCTCCCTACTGCAGCTT, (2) inactivation of unused primers and deoxynucleotide triphosphates by treatment with a mixture of shrimp alkaline phosphatase and exonuclease, (3) performing the primer extension reaction using an aliquot of the PCR product and probe GAGCCTCAGAAGAAATGCAGCTSTGAC that would be extended by one base corresponding to the allele(s) of rs4406273 (A and/or G), (4) inactivation of unused probe by treatment with alkaline phosphatase, and (5) identification of the added base by electrophoresis on an Applied Biosystems capillary electrophoresis apparatus using LIZ120 size standard ladder (Applied Biosystems, Foster City, CA). The utility of the rs4406273-A allele as a surrogate for HLA-C*06:02 was assessed using various metrics (Table 1). Allele frequencies were very similar in all three cohorts, with the A allele of rs4406273 slightly less abundant in the Michigan and Pakistani samples and slightly more abundant in the Thai sample than HLA-C*06:02. LD between the two variants, as measured by the D′ and r2 coefficients, was 0.95 or greater in all three samples. Genotype concordances were also uniformly high (0.984–0.996). The correspondence of cross-classified allele counts for the rs4406273 A and C alleles on the one hand and HLA-C* 06:02 and non-C:06:02 alleles on the other hand were also assessed by six different measures for the performance of a binary classification test—sensitivity, specificity, positive predictive value, negative predictive value, accuracy, and the Matthews correlation coefficient (Matthews, 1975), which is the Pearson correlation coefficient between two binary classifications. Values for these performance measures were very high, ranging from 0.990–0.999 for the Michigan sample, 0.965–0.998 for the Pakistani sample, and 0.976–1.000 for the Thai sample. Table 1 Performance of the rs4406273-A allele as a surrogate for HLA-C*06:02. In Table 2A, we compare the results of a logistic regression test for association between psoriasis and dosage of the HLA-C*06:02 and rs4406273-A alleles. In all three cohorts, the odds ratio (OR) estimates and p-values for rs4406273 are slightly conservative compared to those of HLA-C*06:02, suggesting that this marker is unlikely to yield false positive results. Conditional haplotype testing of independent effects (Table 2B) shows that residual effects after conditioning are negligible compared to the association p-values. Table 2 We also assessed the performance of rs4406273 as a surrogate for 928 individuals from 13 different populations in phase 1 of the 1000 Genomes Project (Abecasis et al., 2012) for which sequence-based genotypes of HLA-C and rs4406273 were available (Gourraud et al., 2014); ftp://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/working/20140725_hla_genotypes/ and ftp://ftp-trace.ncbi.nih.gov/1000genomes/ftp/release/20110521/). LD was very strong between rs4406273 and HLA-C*06:02 in four populations of European descent from the United States, Finland, Great Britain and Italy (r2 = 0.984) and in three Asian populations from Japan and China (r2 = 1.000). LD values were somewhat lower but still strong in two African populations from Nigeria and Kenya (r2 = 0.929) and in four American populations from Puerto Rico, Colombia, and the United States (r2 = 0.909). The results presented here demonstrate that genotyping rs4406273 can be used as an excellent substitute for more elaborate and expensive genotyping of HLA-C*06:02 in people of European, Pakistani, Thai, Chinese, or Japanese ancestry. This SNP may also be a serviceable surrogate for HLA-C*06:02 in some African and American populations. Caution is warranted, however, when applying this method to genetic isolates or more distantly related populations. While not amenable to the popular Taqman assay due to the presence of proximal SNPs, any method employing primer extension can be used to genotype rs4406273. For high-throughput genotyping projects using commercial microarrays, this SNP can be added on as a custom marker if not already present as part of the standard set.

Founder mutation c.676insC in three unrelated Kindler syndrome families belonging to a particular clan from Pakistan

The current study in which we determined the genetic causeof KS in three unrelated Qureshi f amilies adhered to the tenantsof the Declaration of Helsinki and was approved by the EthicsCommittee of PMAS Arid Agriculture, University of Rawalpindi.The genomic DNA of the subjects were amplified by polymer-ase chain reaction (PCR) and sequenced (ABI sequencer 3130;Applied Biosystems, Foster City, CA, USA) using primersdescribed elsewhere.

Association of CACNA1C with bipolar disorder among the Pakistani population

Many single nucleotide polymorphisms (SNPs) have been identified for Bipolar disorder (BD), but association between SNPs and BD can vary depending on the population tested. SNPs rs10994336 and rs9804190 in ANK3 and rs1006737 in CACNA1C have emerged as the most highly replicated SNPs significantly associated with BD. The aim of the present study was to assess the association of these SNPs with BD in the Pakistani population, which has never before been examined. A total of 120 BD and 120 control individuals from Pakistan were examined in this analysis. Genotyping results indicated that rs1006737 in CACNA1C was significantly associated with BD, while rs10994336 or rs9804190 in ANK3 was not significant when examined individually. However, risk score assessment found that the presence of two or more risk alleles was significantly associated with disease, indicating that risk alleles from ANK3 and CACNA1C may additively contribute to BD. A protein-protein interaction network was generated using STRING to probe the relationship between ANK3 and CACNA1C interactors and their associations with BD. While none of the interactors are directly linked to BD, they play a role in pathways linked to BD, including oxytocin and dopamine signaling pathways. Collectively, these results reveal a significant association of CACNA1C with BD among the Pakistani population, extending results from other ethnic groups to the Pakistani population for the first time.

Single nucleotide polymorphisms in asthma candidate genes TBXA2R , ADAM33 FCER1B and ORMDL3 in Pakistani asthmatics a case control study

BackgroundGenetic variations in different loci and genes are important in asthma pathogenesis. There is much importance of various immunological pathways in the IgE secretion regulation. Alterations in any main part of these pathways can increase the risk of asthma development. Polymorphisms in these genetic markers can effect certain pathways which predict the asthma susceptibility. In the present study, SNPs directly or indirectly affecting the immunological process pathways are selected.MethodsThis study was conducted to determine association of 16 SNPs in 10 candidate genes with asthma in Pakistani population in 333 asthmatic cases and 220 healthy controls. Genotyping was performed using the Sequenom Mass ARRAY iPLEX platform (14 SNPs) and TaqMan assay (2 SNPs).ResultsThe minor allele at two of the SNPs showed association with protection from asthma, rs1131882 in TBXA2R gene (OR 0.73, 95% CI 0.52–1.01, P = 0.05) and rs2280091 in the ADAM33 gene (OR 0.69, 95% CI 0.50–0.97, P = 0.03). For FCER1B gene, rs2583476 the asthmatic male gender had higher TT genotype counts as compared to controls (OR = 1.86, 95% CI = 1.09–3.17, p = 0.01). In rs11650680 of ORMDL3 gene the CT genotype is more prevalent in female asthma cases in comparison with female controls (OR = 1.99, 95% CI = 1.02–3.89, p = 0.03).ConclusionsThis data suggests that variations at TBXA2R and ADAM33 genes are found to be associated with asthma susceptibility in Pakistan. FCER1B gene is associated with male and ORMDL3 in female asthmatics. These genetic markers can be important source of asthma risk in Pakistani population.

Development of amplified fragment length polymorphism (AFLP) markers for the identification of Cholistani cattle

Abstract The identification issue of livestock can be resolved by using molecular identification tools that are acceptable to preserve and maintain pure breeds worldwide. The application of a molecular identification methodology is more important for developing nations, e.g., Pakistan, where uncontrolled crossbreeding has become a common practice and the import of exotic animals and germplasm is ever increasing. This presents a risk to local breeds as also stated by the FAO. Therefore, the current study was designed to develop standard molecular markers for Cholistani cattle to ascertain their purity for breeding purpose. In this study 50 and 48 unrelated males were sampled for Cholistani and each crossbred cattle, respectively. Candidate molecular markers present in Cholistani but absent in crossbred cattle and vice versa were detected using the amplified fragment length polymorphism (AFLP) method. Eleven markers were developed and were converted to single nucleotide polymorphism (SNP) markers for genotyping. The allele frequencies in both breeds were determined for discrimination ability using polymerase-chain-reaction–restriction-fragment-polymorphism (PCR-AFLP). The probability of identifying the Cholistani breed was 0.905 and the probability of misjudgment was 0.073 using a panel of markers. The identified markers can ascertain the breed purity and are likely to extend the facility for breed purity testing before entering into a genetic improvement program in the country.

Identification of Metabolic risk phenotypes predisposing to Non-Alcoholic Fatty Liver Disease in a Pakistani Cohort

Objectives: Non-alcoholic fatty liver disease (NAFLD) has emerged in the last two decades with worldwide prevalence of 25.24%. Due to its increasing frequency in Pakistan, it was aimed to identify disease predisposing metabolic risks and their association with NAFLD. Methods: Anthropometric and biochemical investigations were collected from 1366 subjects with minor metabolic disturbances. Comparative analyses were performed to compute frequencies of common metabolic risk phenotypes while their associations with NAFLD were explored using regression analyses. The prevalence of NAFLD was also estimated in total, age, and gender-based population cohorts. Results: Among metabolic risk phenotypes obesity, hyperglycemia, hypertension, and dyslipidemia significantly associated (p<0.001) with NAFLD risk irrespective of age, gender, and BMI. Prevalence of NAFLD in total study cohort was 14.8%, 16.1% in males, 13.4% in females, 19.9% in ≥40 years and 8.7% in ≤40 years respectively. Conclusion: General Pakistani populations experiencing common metabolic disturbances are at high risk of NAFLD development, especially male gender and advanced age. Based on these parameters the stratified NAFLD population could be treated accordingly.

An angiotensin I-converting enzyme insertion/deletion polymorphism is associated with Pakistani asthmatic cases and controls

Asthma is a chronic disease due to inflammation of the airways of lungs that is clinically characterized by variable symptoms including wheezing, coughing and shortness of breath. Angiotensin I-converting enzyme (ACE) plays a major role in fibrous tissue formation and is highly expressed in lungs. The main aim of this research work was to study the role of ACE insertion/deletion (I/D) polymorphism, rs4646994, in asthma in Pakistani patients. A total of 854 subjects, including 333 asthma patients and 521 ethnically matched controls, were studied. The ACE (I/D) polymorphism was genotyped using polymerase chain reaction (PCR). Chi-square, Fisher’s exact and Hardy–Weinberg equilibrium tests were used to compare groups. Homozygous insertion genotype II (p<0.0001, OR=3.38) and insertion allele (I) was significantly more frequent in Pakistani asthmatics than in healthy controls (p=0.0007, OR=1.40). The ID genotype (p<0.0001, OR=0.43) and the deletion allele (D) were associated with protection of disease in Pakistani patients (p=0.0007, OR=0.71). These data suggest the involvement of ACE I/D polymorphism in asthma risk in the Pakistani population. This marker may be an important indication in the molecular mechanism of asthma and can become a useful tool in risk assessment and help in designing strategy to combat disease.

Compound heterozygous mutations p.Q1530X and 6103delG in COL7A1 causing recessive dystrophic epidermolysis bullosa in a Pakistani family

1 Elliot RB. Wrinkling of skin in cystic fibrosis. Lancet 1974; ii: 108 (Letter). 2 Berk D, Ciliberto H, Sweet S, Ferkol T, Bayliss S. Aquagenic wrinkling of the palms in cystic fibrosis. Arch Dermatol 2009; 145(11): 1296–1299. 3 Gild R, Clay C, Morey S. Aquagenic wrinkling of the palms in cystic fibrosis and the cystic fibrosis carrier state: a case-control study. Br J Dermatol 2010; 163: 1082–1084. 4 Stewart L, Doe S, Bourke S, Leech S. Aquagenic palmar wrinkling as a presenting feature of cystic fibrosis gene dysfunction. Clin Exp Dermatol 2009; 34: e647–e649. 5 Luo D. Aquagenic acrokeratoderma: a case with family history and unusual involvements of the palms and soles, and the dorsum of fingers and toes. J Dermatol 2011; 38(6): 612–615. 6 Davis L, Woody C. Idiopathic aquagenic wrinkling of the palms. Pediatr Dermatol 2004; 21: 180.