Gijs A. van der Marel

Intracellular bacterial growth is controlled by a kinase network around PKB/AKT1.

With the emergence of multidrug resistant (MDR) bacteria, it is imperative to develop new intervention strategies. Current antibiotics typically target pathogen rather than host-specific biochemical pathways. Here we have developed kinase inhibitors that prevent intracellular growth of unrelated pathogens such as Salmonella typhimurium and Mycobacterium tuberculosis. An RNA interference screen of the human kinome using automated microscopy revealed several host kinases capable of inhibiting intracellular growth of S. typhimurium. The kinases identified clustered in one network around AKT1 (also known as PKB). Inhibitors of AKT1 prevent intracellular growth of various bacteria including MDR-M. tuberculosis. AKT1 is activated by the S. typhimurium effector SopB, which promotes intracellular survival by controlling actin dynamics through PAK4, and phagosome–lysosome fusion through the AS160 (also known as TBC1D4)–RAB14 pathway. AKT1 inhibitors counteract the bacterial manipulation of host signalling processes, thus controlling intracellular growth of bacteria. By using a reciprocal chemical genetics approach, we identified kinase inhibitors with antibiotic properties and their host targets, and we determined host signalling networks that are activated by intracellular bacteria for survival.

Transglycosidase Activity of Chitotriosidase IMPROVED ENZYMATIC ASSAY FOR THE HUMAN MACROPHAGE CHITINASE

Chitotriosidase is a chitinase that is massively expressed by lipid-laden tissue macrophages in man. Its enzymatic activity is markedly elevated in serum of patients suffering from lysosomal lipid storage disorders, sarcoidosis, thalassemia, and visceral Leishmaniasis. Monitoring of serum chitotriosidase activity in Gaucher disease patients during progression and therapeutic correction of their disease is useful to obtain insight in changes in body burden on pathological macrophages. However, accurate quantification of chitotriosidase levels by enzyme assay is complicated by apparent substrate inhibition, which prohibits the use of saturating substrate concentrations. We have therefore studied the catalytic features of chitotriosidase in more detail. It is demonstrated that the inhibition of enzyme activity at excess substrate concentration can be fully explained by transglycosylation of substrate molecules. The potential physiological consequences of the ability of chitotriosidase to hydrolyze as well as transglycosylate are discussed. The novel insight in transglycosidase activity of chitotriosidase has led to the design of a new substrate molecule, 4-methylumbelliferyl-(4-deoxy)chitobiose. With this substrate, which is no acceptor for transglycosylation, chitotriosidase shows normal Michaelis-Menten kinetics, resulting in major improvements in sensitivity and reproducibility of enzymatic activity measurements. The novel convenient chitotriosidase enzyme assay should facilitate the accurate monitoring of Gaucher disease patients receiving costly enzyme replacement therapy.

AT base pairs are less stable than GC base pairs in Z-DNA: The crystal structure of d(m5CGTAm5CG)

Two hexanucleoside pentaphosphates , 5-methyl and 5-bromo cytosine derivatives of d( CpGpTpApCpG ) have been synthesized, crystallized, and their three-dimensional structure solved. They both form left-handed Z-DNA and the methylated derivative has been refined to 1.2 A resolution. These are the first crystal Z-DNA structures that contain AT base pairs. The overall form of the molecule is very similar to that of the unmethylated or the fully methylated (dC-dG)3 hexamer although there are slight changes in base stacking. However, significant differences are found in the hydration of the helical groove. When GC base pairs are present, the helical groove is systematically filled with two water molecules per base pair hydrogen bonded to the bases. Both of these water molecules are not seen in the electron density map in the segments of the helix containing AT base pairs, probably because of solvent disorder. This could be one of the features that makes AT base pairs form Z-DNA less readily than GC base pairs.

Triple helix formation by oligopurine-oligopyrimidine DNA fragments : electrophoretic and thermodynamic behavior

The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem. When h is mixed with d(CTTCCTCCTCT) (s1) the two strands co-migrate in polyacrylamide gel electrophoresis at pH 5. If s1 is substituted with d(TCTCCTCCTTC) (s2), such behavior is not observed and the two strands migrate separately. This supports the suggestion of the formation of a triple-stranded structure by h and s1 (h:s1) but not by h and s2, and confirms the strand polarity requirement of the third pyrimidine strand, which is necessary for this type of structure. The formation of a triple helix by h:s1 is supported by electrophoretic mobility data (Ferguson plot) and by enzymatic assay with DNase I. Circular dichroism measurements show that, upon triple helix formation, there are two negative ellipticities: a weaker one (delta epsilon = 80 M-1 cm-1) at 242 nm and a stronger one (delta epsilon = 210 M-1 cm-1) at 212 nm. The latter has been observed also in triple-stranded polynucleotides, and can be considered as the trademark for a Py:Pu:Py DNA triplex. Comparison of ultraviolet absorption at 270 nm and temperature measurements shows that the triple-stranded structure melts with a biphasic profile. The lower temperature transition is bimolecular and is attributable to the breakdown of the triplex to give h and s1, while the higher temperature transition is monomolecular and is due to the transition of hairpin to coil structure. The duplex-to-triplex transition is co-operative, fully reversible and with a hyperchromism of about 10%. The analysis of the melting curves, with a three-state model, allows estimation of the thermodynamic parameters of triple helix formation. We found that the duplex-to-triplex transition of h: s1 is accompanied by an average change in enthalpy (less the protonation contribution) of -73(+/- 5) kcal/mol of triplex, which corresponds to -6.6(+/- 0.4) kcal/mol of binding pyrimidine, attributable to stacking and hydrogen bonding interactions.

Biomarkers in the diagnosis of lysosomal storage disorders: proteins, lipids, and inhibodies

A biomarker is an analyte indicating the presence of a biological process linked to the clinical manifestations and outcome of a particular disease. In the case of lysosomal storage disorders (LSDs), primary and secondary accumulating metabolites or proteins specifically secreted by storage cells are good candidates for biomarkers. Clinical applications of biomarkers are found in improved diagnosis, monitoring disease progression, and assessing therapeutic correction. These are illustrated by reviewing the discovery and use of biomarkers for Gaucher disease and Fabry disease. In addition, recently developed chemical tools allowing specific visualization of enzymatically active lysosomal glucocerebrosidase are described. Such probes, coined inhibodies, offer entirely new possibilities for more sophisticated molecular diagnosis, enzyme replacement therapy monitoring, and fundamental research.

The Telomeric GGGTTA Repeats of Trypanosoma Brucei Contain the Hypermodified Base J in Both Strands

We have previously shown that nuclear DNA of bloodstream from Trypanosoma brucei contains a novel base beta-glucosyl-hydroxymethyluracil, called J. Base J is enriched in minichromosome fractions but not in the minichromosome internal repeats, suggesting the association of J with telomeric DNA. To test whether J is present in the long telomeric (GGGTTA)n repeat arrays, which are 2-26 kb in T.brucei, we have purified these arrays both by hybrid selection and by isolating 2-26 kb fragments from DNA digested with multiple restriction enzymes. We find that in purified telomeric repeats approximately 13% of T is replaced by J, compared to 0.8% in total DNA, and we estimate that approximately 50% of the total J is in these repeats. Highly purified complementary strands of the repeats were obtained by alkaline CsCl equilibrium centrifugation. In the (TAACCC)n strand 14% of T was replaced by J. In the (GGGTTA)n strand approximately 36% of the second T was replaced by J; the first T was not detectably replaced. Modified bases have not been found in telomeric repeats before. How the bulky base J affects telomere function and structure in bloodstream form trypanosomes remains to be determined.

Photoaffinity Labeling in Activity-Based Protein Profiling

Activity-based protein profiling has come to the fore in recent years as a powerful strategy for studying enzyme activities in their natural surroundings. Substrate analogs that bind covalently and irreversibly to an enzyme active site and that are equipped with an identification or affinity tag can be used to unearth new enzyme activities, to establish whether and at what subcellular location the enzymes are active, and to study the inhibitory effects of small compounds. A specific class of activity-based protein probes includes those that employ a photo-activatable group to create the covalent bond. Such probes are targeted to those enzymes that do not employ a catalytic nucleophile that is part of the polypeptide backbone. An overview of the various photo-activatable groups that are available to chemical biology researchers is presented, with a focus on their (photo)chemistry and their application in various research fields. A number of comparative studies are described in which the efficiency of various photo-activatable groups are compared.

The modified base J is the target for a nove lDNA‐binding protein in kinetoplastid protozoans

DNA from Kinetoplastida contains the unusual modified base β‐D‐glucosyl(hydroxymethyl)uracil, called J. Base J is found predominantly in repetitive DNA and correlates with epigenetic silencing of telomeric variant surface glycoprotein genes in Trypanosoma brucei. We have now identified a protein in nuclear extracts of bloodstream stage T.brucei that binds specifically to J‐containing duplex DNA. J‐specific DNA binding was also observed with extracts from the kinetoplastids Crithidia fasciculata and Leishmania tarentolae. We purified the 90 kDa C.fasciculata J‐binding protein 50 000‐fold and cloned the corresponding gene from C.fasciculata, T.brucei and L.tarentolae. Recombinant proteins expressed in Escherichia coli demonstrated J‐specific DNA binding. The J‐binding proteins show 43–63% identity and are unlike any known protein. The discovery of a J‐binding protein suggests that J, like methylated cytosine in higher eukaryotes, functions via a protein intermediate.

Synthesis of peptides containing a sulfinamide or a sulfonamide transition-state isostere

A versatile synthesis of peptides incorporating the sulfinamide or sulfonamide transition-state analogue is described. Apart from the easily accessible Gly-Xxx isosteres used as haptens to elicit catalytic antibodies, other amino acids than Gly can be prepared by α-alkylation of the sulfonamide containing peptides. This is illustrated with the synthesis of a potential HIV-protease inhibitor 27.

Inhibitors of prenylation of Ras and other G-proteins and their application as therapeutics

Anchoring of small G-proteins to cellular membranes via a covalently bound lipophylic prenyl group is essential for the functioning of these proteins. For example, the farnesylation of Ras by the action of the enzyme protein:farnesyl transferase (PFT) is pivotal for its signalling function in cell growth and differentiation. The development of inhibitors of PFT was triggered by the role of mutated Ras in certain types of cancer and by the observation that non-farnesylated Ras is inactive. Besides the screening of existing compounds for PFT inhibition, rational drug design has also led to new inhibitors. Our research is in the field of atherosclerosis and concerns the development of inhibitors of the growth of vascular smooth muscle cells. The latter process gives rise to reocclusion of the coronary artery (restenosis) after balloon angioplasty. We and others have developed several analogues of the two substrates of PFT, i.e. farnesyl pyrophosphate (FPP) and the so-called CAAX peptide consensus sequence, which were tested in vitro for the inhibition of PFT and of other enzymes involved in protein prenylation, such as protein:geranylgeranyl transferase-1 (PGGT-1). The FPP analogue TR006, a strong inhibitor of PFT (IC(50) of 67 nM), blocked the proliferation of cultured human smooth muscle cells and inhibited platelet-derived growth factor- and basic fibroblast growth factor-induced DNA synthesis. Similar but more highly charged compounds failed in this respect, probably because of an impaired uptake in the cells. Less charged derivatives were designed to circumvent this problem. The effect on the GF-induced activation of intermediates in signal transduction pathways was investigated in order to gain insight into the mechanism of action within the cells. TR006 decreased the bFGF activation of extracellular signal-regulated kinase 1 (ERK1), suggesting its involvement in inhibiting Ras activity. Although other analogues inhibited DNA synthesis, they affected neither ERK1 activation nor p38/stress-activated protein kinase 2 or Jun N-terminal kinase 1 activation. Since some of these compounds were also shown to be inhibitors of in vitro PGGT-1 activity, the geranylgeranylation of other G-proteins may be decreased by these compounds. Rho seems to be a good candidate as a target for inhibitors of PGGT-1. This uncertainty as to the mechanism of action within non-transformed as well as transformed cells applies to all prenylation inhibitors, but is not holding back their further development as drugs. Their current and possible future application as therapeutics in cancer, restenosis, angiogenesis, and osteoporosis is briefly discussed.