Jacques H. van Boom

Major transcript of the frameshifted coxII gene from trypanosome mitochondria contains four nucleotides that are not encoded in the DNA

The mitochondrial cytochrome oxidase (cox) subunit II gene from trypanosomes contains a frameshift at amino acid 170. This gene is highly conserved in different trypanosome species, suggesting that it is functional. Sequence determination of coxII transcripts of T. brucei and C. fasciculata reveals four extra, reading frame-restoring nucleotides at the frameshift position that are not encoded in the DNA. Southern blot analysis of DNA of both trypanosome species failed to show the existence of a second version of the coxII gene. We conclude, therefore, that the extra nucleotides are added during or after transcription of the frameshift gene by an RNA-editing process.

Protein-primed RNA synthesis by purified poliovirus RNA polymerase

A small protein, VPg, is covalently linked to the 5′ end of the plus-stranded poliovirus genomic RNA. Poliovirus messenger RNA, identical in nucleotide sequence to genomic RNA, is not capped at its 5′ end by the methylated structure that is common to most eukaryotic mRNAs. These discoveries presented two problems. First, as cap structures are usually required for translation of mRNA into protein, how does this uncapped viral RNA act as a template for translation? Second, what is the function of VPg? The identification of the internal ribosomal-entry site, which allows the entry of ribosomes into viral mRNA independently of the 5′ mRNA end, has solved the first conundrum. Here we describe the resolution of the second problem. VPg is linked to the genomic RNA through the 5′-terminal uridylic acid of the RNA. We show that VPg can be uridylylated by the poliovirus RNA polymerase 3Dpol. Uridylylated VPg can then prime the transcription of polyadenylate RNA by 3Dpol to produce VPg-linked poly(U). Initiation of transcription of the poliovirus genome from the polyadenylated 3′ end therefore depends on VPg.

Amino-acid substitutions at codon 13 of the N-ras oncogene in human acute myeloid leukaemia

DNAs from four out of five patients with acute myeloid leukaemia (AML) tested by an in vivo selection assay in nude mice using transfected mouse NIH 3T3 cells were found to contain an activated N-ras oncogene. Using a set of synthetic oligonucleotide probes, we have detected a mutation at codon 13 in all four genes. The same codon is mutated in an additional AML DNA that is positive in the focus-formation assay on 3T3 cells. DNA from the peripheral blood of one patient in remission does not contain a codon 13 mutation.

Identification of an RNA Hairpin in Poliovirus RNA That Serves as the Primary Template in the In Vitro Uridylylation of VPg

ABSTRACT The first step in the replication of the plus-stranded poliovirus RNA is the synthesis of a complementary minus strand. This process is initiated by the covalent attachment of UMP to the terminal protein VPg, yielding VPgpU and VPgpUpU. We have previously shown that these products can be made in vitro in a reaction that requires only synthetic VPg, UTP, poly(A), purified poliovirus RNA polymerase 3Dpol, and Mg2+ (A. V. Paul, J. H. van Boom, D. Filippov, and E. Wimmer, Nature 393:280–284, 1998). Since such a poly(A)-dependent process cannot confer sufficient specificity to poliovirus RNA replication, we have developed a new assay to search for a viral RNA template in conjunction with viral or cellular factors that could provide this function. We have now discovered a small RNA hairpin in the coding region of protein 2C as the site in PV1(M) RNA that is used as the primary template for the in vitro uridylylation of VPg. This hairpin has recently been described in poliovirus RNA as being an essential structure for the initiation of minus strand RNA synthesis (I. Goodfellow, Y. Chaudhry, A. Richardson, J. Meredith, J. W. Almond, W. Barclay, and D. J. Evans, J. Virol. 74:4590–4600, 2000). The uridylylation reaction either with transcripts of cre(2C) RNA or with full-length PV1(M) RNA as the template is strongly stimulated by the addition of purified viral protein 3CDpro. Deletion of the cre(2C) RNA sequences from minigenomes eliminates their ability to serve as template in the reaction. A similar signal in the coding region of VP1 in HRV14 RNA (K. L. McKnight and S. M. Lemon, RNA 4:1569–1584, 1998) and the poliovirus cre(2C) can be functionally exchanged in the assay. The mechanism by which the VPgpUpU precursor, made specifically on the cre(2C) template, might be transferred to the site where it serves as primer for poliovirus RNA synthesis, remains to be determined.

The conformation of neurotensin bound to its G protein-coupled receptor

G protein-coupled receptors (GPCRs) mediate the perception of smell, light, taste, and pain. They are involved in signal recognition and cell communication and are some of the most important targets for drug development. Because currently no direct structural information on high-affinity ligands bound to GPCRs is available, rational drug design is limited to computational prediction combined with mutagenesis experiments. Here, we present the conformation of a high-affinity peptide agonist (neurotensin, NT) bound to its GPCR NTS-1, determined by direct structural methods. Functional receptors were expressed in Escherichia coli, purified in milligram amounts by using optimized procedures, and subsequently reconstituted into lipid vesicles. Solid-state NMR experiments were tailored to allow for the unequivocal detection of microgram quantities of 13C,15N-labeled NT(8–13) in complex with functional NTS-1. The NMR data are consistent with a disordered state of the ligand in the absence of receptor. Upon receptor binding, the peptide undergoes a linear rearrangement, adopting a β-strand conformation. Our results provide a viable structural template for further pharmacological investigations.

Genetic and Biochemical Studies of Poliovirus cis-Acting Replication Element cre in Relation to VPg Uridylylation

ABSTRACT In addition to highly conserved stem-loop structures located in the 5′- and 3′-nontranslated regions, genome replication of picornaviruses requires cis-acting RNA elements located in the coding region (termed cre) (K. L. McKnight and S. M. Lemon, J. Virol. 70:1941–1952, 1996; P. E. Lobert, N. Escriou, J. Ruelle, and T. Michiels, Proc. Natl. Acad. Sci. USA 96:11560–11565, 1999; I. Goodfellow, Y. Chaudhry, A. Richardson, J. Meredith, J. W. Almond, W. Barclay, and D. J. Evans, J. Virol. 74:4590–4600, 2000). cre elements appear to be essential for minus-strand RNA synthesis by an as-yet-unknown mechanism. We have discovered that the cre element of poliovirus (mapping to the 2C coding region of poliovirus type 1; nucleotides 4444 to 4505 in 2C), which is homologous to thecre element of poliovirus type 3, is preferentially used as a template for the in vitro uridylylation of VPg catalyzed by 3Dpol in a reaction that is greatly stimulated by 3CDpro (A. V. Paul, E. Rieder, D. W. Kim, J. H. van Boom, and E. Wimmer, J. Virol. 74:10359–10370, 2000). Here we report a direct correlation between mutations that eliminate, or severely reduce, the in vitro VPg-uridylylation reaction and produce replication phenotypes in vivo. None of the genetic changes significantly influenced translation or polyprotein processing. A substitution mapping to the first A (A4472C) of a conservedAAACA sequence in the loop of PV-cre(2C) eliminated the ability of the cre RNA to serve as template for VPg uridylylation and abolished RNA infectivity. Mutagenesis of the second A (A4473C; AAACA) severely reduced the yield of VPgpUpU and RNA infectivity was restored only after reversion to the wild-type sequence. The effect of substitution of the third A (A4474G; AAACA) was less severe but reduced both VPg uridylylation and virus yield. Disruption of base pairing within the upper stem region of PV-cre(2C) also affected uridylylation of VPg. Virus derived from transcripts containing mutations in the stem was either viable or quasi-infectious.

Transglycosidase Activity of Chitotriosidase IMPROVED ENZYMATIC ASSAY FOR THE HUMAN MACROPHAGE CHITINASE

Chitotriosidase is a chitinase that is massively expressed by lipid-laden tissue macrophages in man. Its enzymatic activity is markedly elevated in serum of patients suffering from lysosomal lipid storage disorders, sarcoidosis, thalassemia, and visceral Leishmaniasis. Monitoring of serum chitotriosidase activity in Gaucher disease patients during progression and therapeutic correction of their disease is useful to obtain insight in changes in body burden on pathological macrophages. However, accurate quantification of chitotriosidase levels by enzyme assay is complicated by apparent substrate inhibition, which prohibits the use of saturating substrate concentrations. We have therefore studied the catalytic features of chitotriosidase in more detail. It is demonstrated that the inhibition of enzyme activity at excess substrate concentration can be fully explained by transglycosylation of substrate molecules. The potential physiological consequences of the ability of chitotriosidase to hydrolyze as well as transglycosylate are discussed. The novel insight in transglycosidase activity of chitotriosidase has led to the design of a new substrate molecule, 4-methylumbelliferyl-(4-deoxy)chitobiose. With this substrate, which is no acceptor for transglycosylation, chitotriosidase shows normal Michaelis-Menten kinetics, resulting in major improvements in sensitivity and reproducibility of enzymatic activity measurements. The novel convenient chitotriosidase enzyme assay should facilitate the accurate monitoring of Gaucher disease patients receiving costly enzyme replacement therapy.

AT base pairs are less stable than GC base pairs in Z-DNA: The crystal structure of d(m5CGTAm5CG)

Two hexanucleoside pentaphosphates , 5-methyl and 5-bromo cytosine derivatives of d( CpGpTpApCpG ) have been synthesized, crystallized, and their three-dimensional structure solved. They both form left-handed Z-DNA and the methylated derivative has been refined to 1.2 A resolution. These are the first crystal Z-DNA structures that contain AT base pairs. The overall form of the molecule is very similar to that of the unmethylated or the fully methylated (dC-dG)3 hexamer although there are slight changes in base stacking. However, significant differences are found in the hydration of the helical groove. When GC base pairs are present, the helical groove is systematically filled with two water molecules per base pair hydrogen bonded to the bases. Both of these water molecules are not seen in the electron density map in the segments of the helix containing AT base pairs, probably because of solvent disorder. This could be one of the features that makes AT base pairs form Z-DNA less readily than GC base pairs.

Triple helix formation by oligopurine-oligopyrimidine DNA fragments : electrophoretic and thermodynamic behavior

The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem. When h is mixed with d(CTTCCTCCTCT) (s1) the two strands co-migrate in polyacrylamide gel electrophoresis at pH 5. If s1 is substituted with d(TCTCCTCCTTC) (s2), such behavior is not observed and the two strands migrate separately. This supports the suggestion of the formation of a triple-stranded structure by h and s1 (h:s1) but not by h and s2, and confirms the strand polarity requirement of the third pyrimidine strand, which is necessary for this type of structure. The formation of a triple helix by h:s1 is supported by electrophoretic mobility data (Ferguson plot) and by enzymatic assay with DNase I. Circular dichroism measurements show that, upon triple helix formation, there are two negative ellipticities: a weaker one (delta epsilon = 80 M-1 cm-1) at 242 nm and a stronger one (delta epsilon = 210 M-1 cm-1) at 212 nm. The latter has been observed also in triple-stranded polynucleotides, and can be considered as the trademark for a Py:Pu:Py DNA triplex. Comparison of ultraviolet absorption at 270 nm and temperature measurements shows that the triple-stranded structure melts with a biphasic profile. The lower temperature transition is bimolecular and is attributable to the breakdown of the triplex to give h and s1, while the higher temperature transition is monomolecular and is due to the transition of hairpin to coil structure. The duplex-to-triplex transition is co-operative, fully reversible and with a hyperchromism of about 10%. The analysis of the melting curves, with a three-state model, allows estimation of the thermodynamic parameters of triple helix formation. We found that the duplex-to-triplex transition of h: s1 is accompanied by an average change in enthalpy (less the protonation contribution) of -73(+/- 5) kcal/mol of triplex, which corresponds to -6.6(+/- 0.4) kcal/mol of binding pyrimidine, attributable to stacking and hydrogen bonding interactions.

High-affinity binding of a synthetic heptaglucoside and fungal glucan phytoalexin elicitors to soybean membranes

Soybean membranes possess high‐affinity binding sites for fungal β‐glucans that elicit phytoalexin synthesis. The ability of 1,3‐1,6‐β‐glucans, released by acid hydrolysis from mycelial walls of Phytophthora megasperma f.sp. glycinea, to compete for the putative phytoalexin elicitor receptors increases with their average degree of polymerization (DP). The results suggest a function where the probability for glucan fragments of containing a structural determinant that is optimal for binding approaches 1 as the DP tends to infinity. Ligand displacement data obtained against a 125I‐labeled glucan elicitor (average DP= 18) provided a theoretical minimum IC50 (50% inhibitory concentration) for 1,3‐1,6‐β‐glucans of 3 nM. The IC50 value obtained for a synthetic hepta‐β‐glucoside having a known elicitor‐active structure was 8 nM, remarkably close to the predicted value. Displacement of the 125I‐glucan of large DP was uniform and complete showing that the heptaglucoside had access, with similar affinity, to all sites available to the radioligand. Further analysis using a 125I‐labeled aminophenethylamine derivative of the heptaglucoside suggested that the putative glucan‐elicitor receptors bind a basic structural determinant present in all elicitor‐active glucans from the soybean pathogen P. megasperma.