Glen B. Legge

Biophysical characterization of DNA aptamer interactions with vascular endothelial growth factor

The binding of a DNA aptamer (5′‐CCGTCTTCCAGACAAGAGTGCAGGG‐3′) to recombinant human vascular endothelial growth factor (VEGF165) was characterized using surface plasmon resonance (SPR), fluorescence anisotropy and isothermal titration calorimetry (ITC). Results from both fluorescence anisotropy and ITC indicated that a single aptamer molecule binds to each VEGF homodimer, unlike other VEGF inhibitors that exhibit 2(ligand):1(VEGF homodimer) stoichiometry. In addition, ITC revealed that the association of the aptamer to VEGF at 20°C is enthalpically driven, with an unfavorable entropy contribution. SPR kinetic studies, with careful control of possible mass transfer effects, demonstrated that the aptamer binds to VEGF with an association rate constant kon = 4.79 ± 0.03 × 104 M−1 s−1 and a dissociation rate constant koff = 5.21 ± 0.02 × 10−4 s−1 at 25°C. Key recognition hot‐spots were determined by a combination of aptamer sequence substitutions, truncations, and extensions. Most single‐nucleotide substitutions, particularly within an mfold‐predicted stem, suppress binding, whereas those within a predicted loop have a minimal effect. The 5′‐end of the aptamer plays a key role in VEGF recognition, as a single‐nucleotide truncation abolished VEGF binding. Conversely, an 11‐fold increase in the association rate (and affinity) is observed with a single cytosine nucleotide extension, due to pairing of the 3′‐GGG with 5′‐CCC in the extended aptamer. Our approach effectively maps the secondary structural elements in the free aptamer, which present the unpaired interface for high affinity VEGF recognition. These data demonstrate that a directed binding analysis can be used in concert with library screening to characterize and improve aptamer/ligand recognition.

Novel MicroRNA Candidates and miRNA-mRNA Pairs in Embryonic Stem (ES) Cells

Background MicroRNAs (miRNAs: a class of short non-coding RNAs) are emerging as important agents of post transcriptional gene regulation and integral components of gene networks. MiRNAs have been strongly linked to stem cells, which have a remarkable dual role in development. They can either continuously replenish themselves (self-renewal), or differentiate into cells that execute a limited number of specific actions (pluripotence). Methodology/Principal Findings In order to identify novel miRNAs from narrow windows of development we carried out an in silico search for micro-conserved elements (MCE) in adult tissue progenitor transcript sequences. A plethora of previously unknown miRNA candidates were revealed including 545 small RNAs that are enriched in embryonic stem (ES) cells over adult cells. Approximately 20% of these novel candidates are down-regulated in ES (Dicer −/−) ES cells that are impaired in miRNA maturation. The ES-enriched miRNA candidates exhibit distinct and opposite expression trends from mmu-mirs (an abundant class in adult tissues) during retinoic acid (RA)-induced ES cell differentiation. Significant perturbation of trends is found in both miRNAs and novel candidates in ES (GCNF −/−) cells, which display loss of repression of pluripotence genes upon differentiation. Conclusion/Significance Combining expression profile information with miRNA target prediction, we identified miRNA-mRNA pairs that correlate with ES cell pluripotence and differentiation. Perturbation of these pairs in the ES (GCNF −/−) mutant suggests a role for miRNAs in the core regulatory networks underlying ES cell self-renewal, pluripotence and differentiation.

LFA-1 Affinity Regulation Is Necessary for the Activation and Proliferation of Naive T Cells

The activation of LFA-1 (lymphocyte function-associated antigen) is a critical event for T cell co-stimulation. The mechanism of LFA-1 activation involves both affinity and avidity regulation, but the role of each in T cell activation remains unclear. We have identified antibodies that recognize and block different affinity states of the mouse LFA-1 I-domain. Monoclonal antibody 2D7 preferentially binds to the low affinity conformation, and this specific binding is abolished when LFA-1 is locked in the high affinity conformation. In contrast, M17/4 can bind both the locked high and low affinity forms of LFA-1. Although both 2D7 and M17/4 are blocking antibodies, 2D7 is significantly less potent than M17/4 in blocking LFA-1-mediated adhesion; thus, blocking high affinity LFA-1 is critical for preventing LFA-1-mediated adhesion. Using these reagents, we investigated whether LFA-1 affinity regulation affects T cell activation. We found that blocking high affinity LFA-1 prevents interleukin-2 production and T cell proliferation, demonstrated by TCR cross-linking and antigen-specific stimulation. Furthermore, there is a differential requirement of high affinity LFA-1 in the activation of CD4+ and CD8+ T cells. Although CD4+ T cell activation depends on both high and low affinity LFA-1, only high affinity LFA-1 provides co-stimulation for CD8+ T cell activation. Together, our data demonstrated that the I-domain of LFA-1 changes to the high affinity state in primary T cells, and high affinity LFA-1 is critical for facilitating T cell activation. This implicates LFA-1 activation as a novel regulatory mechanism for the modulation of T cell activation and proliferation.

Model of the αLβ2 integrin I-domain/ICAM-1 DI interface suggests that subtle changes in loop orientation determine ligand specificity

The interaction of the αLβ2 integrin with its cellular ligand the intercellular adhesion molecule‐1 (ICAM‐1) is critical for the tight binding interaction between most leukocytes and the vascular endothelium before transendothelial migration to the sites of inflammation. In this article we have modeled the αL subunit I‐domain in its active form, which was computationally docked with the D1 domain of the ICAM‐1 to probe potential protein‐protein interactions. The experimentally observed key interaction between the carboxylate of Glu 34 in the ICAM‐1 D1 domain and the metal ion‐dependent adhesion site (MIDAS) in the open αL I‐domain was consistently reproduced by our calculations. The calculations reveal the nature of the αLβ2/ICAM‐1 interaction and suggest an explanation for the increased ligand‐binding affinity in the “open” versus the “closed” conformation of the αL I‐domain. A mechanism for substrate selectivity among αL, αM, and α2 I‐domains is suggested whereby the orientation of the loops within the I‐domain is critical in mediating the interaction of the Glu 34 carboxylate of ICAM‐1 D1 with the MIDAS. Proteins 2002;48:151–160.

Spectroscopic Characterization of Successive Phosphorylation of the Tissue Factor Cytoplasmic Region.

Tissue Factor (TF) is well known for its role during the activation of the coagulation pathway, but it is also critical for tumor biology and inflammation through protease activated receptor (PAR) 2 signaling. This signaling function is modulated by the successive phosphorylation of residues Ser253 and Ser258 within the TF cytoplasmic region (TFCR). This paper reports how we used NMR and spectroscopic methods to investigate the structural propensities of the unphosphorylated and phosphorylated forms of the TFCR. When unphosphorylated, the TFCR forms a local hydrophobic collapse around Trp254 and an electropositive patch from the membrane proximal basic block (Arg246-Lys247) to the conserved PKCalpha consensus residue Lys255. Phosphorylation of Ser253 alters the charge characteristics of this membrane proximal region, thereby strengthening the interaction between residue Ala248 and the Trp254 aromatic group. Phosphorylation of the Ser258-Pro259 motif destabilizes a turn at the C-terminus to form an extended polyproline helical motif. Our data suggests that by changing both its charge and local structural propensity, covalent modifications of the TFCR can potentially regulate its association with the cellular membrane and its signaling partners.

2E8 Binds to the High Affinity I-domain in a Metal Ion-dependent Manner A SECOND GENERATION MONOCLONAL ANTIBODY SELECTIVELY TARGETING ACTIVATED LFA-1

The activation of leukocyte function-associated antigen-1 (LFA-1) plays a critical role in regulating immune responses. The metal ion-dependent adhesion site on the I-domain of LFA-1 αL subunit is the key recognition site for ligand binding. Upon activation, conformation changes in the I-domain can lead LFA-1 from the low affinity state to the high affinity (HA) state. Using the purified HA I-domain locked by disulfide bonds for immunization, we developed an mAb, 2E8, that specifically binds to cells expressing the HA LFA-1. The surface plasmon resonance analysis has shown that 2E8 only binds to the HA I-domain and that the dissociation constant (KD) for HA I-domain is 197 nm. The binding of 2E8 to the HA I-domain is metal ion-dependent, and the affinity decreased as Mn2+ was replaced sequentially by Mg2+ and Ca2+. Surface plasmon resonance analysis demonstrates that 2E8 inhibits the interaction of HA I-domain and ICAM-1. Furthermore, we found that 2E8 can detect activated LFA-1 on both JY and Jurkat cells using flow cytometry and parallel plate adhesion assay. In addition, 2E8 inhibits JY cell adhesion to human umbilical vein endothelial cells and homotypic aggregation. 2E8 treatment reduces the proliferation of both human CD4+ and CD8+ T cells upon OKT3 stimulation without the impairment of their cytolytic function. Taken together, these data demonstrate that 2E8 is specific for the high affinity form of LFA-1 and that 2E8 inhibits LFA-1/ICAM-1 interactions. As a novel activation-specific monoclonal antibody, 2E8 is a potentially useful reagent for blocking high affinity LFA-1 and modulating T cell activation in research and therapeutics.

A mechanism for antibody-mediated outside-in activation of LFA-1

MEM83 is an inserted domain (I-domain)-specific antibody that up-regulates the interaction of LFA-1 with ICAM-1 through an outside-in activation mechanism. We demonstrate here that there is no change in the affinity of the MEM83 antibody for the I-domain in either its low (wild-type) or high affinity form and that MEM83 does not enhance the binding of the wild-type I-domain to ICAM-1. Furthermore, we show that the antibody acts as an activating agent to induce LFA-1/ICAM-1-dependent homotypic cell aggregation only as an IgG, but not as a Fab fragment. On the basis of these data, we propose an avidity-based mechanism that requires no direct activation of the LFA-1 I-domain by the binding of the antibody; rather, activation is enhanced when there is an interaction with both arms of the IgG. A molecular model of the antibody interaction with LFA-1 illustrates the symmetry and accessibility of the two MEM83 epitopes across the LFA-1/ICAM-1 heterotetramer. We hypothesize that MEM83 stabilizes adjacent LFA-1 molecules in their active form by the free energy that is gained from the binding of the I-domains to each arm of the IgG. This leads to stabilization of the open state of the integrin and outside-in signaling. Our model supports a mechanism in which both affinity and avidity regulation are required in the activation of LFA-1.

Letter to the Editor: Assignment of 1H, 13C and 15N resonances of the I-domain of human leukocyte function associated antigen-1

The interaction between the integrin leukocyte function associated antigen 1 (LFA-1) and intercellular adhesion molecule 1 (ICAM-1) is primarily mediated via an inserted domain (I-domain) of approximately 190 amino acids (for review see Gahmberg, 1997), which is a common feature of all leukocyte integrins. X-ray structures of the LFA-1 and Mac-1 I-domains in the presence of EDTA or divalent cations are available (see, for example, Qu and Leahy, 1995), and we have recently completed an NMR structure determination (Legge et al., 2000) which was based on the sequencespecific assignments of the LFA-1 I-domain reported in the present paper. These assignments provide the basis for further studies on LFA-1 I-domain/ICAM-1 interactions.

Pactolus I-Domain: Functional Switching of the Rossmann Fold.

Murine Pactolus is a neutrophil‐specific single chain glycoprotein that plays a role as an apoptosis marker for macrophages. The extracellular region of the protein shows strong sequence similarities to integrin β‐subunits. Critical sequence modifications differentiate its function when compared to the integrin family. We show experimentally that Pactolus I‐domain does not bind divalent metal ions, indicating that ligand binding is not mediated through a metal ion‐dependent adhesion site (MIDAS). NMR data was used to map secondary structure and the strand pairing within the β‐sheet to confirm an overall Rossmann fold topology. Homology modeling enhanced by the NMR data was used to determine the overall structure, with two key loop insertions/deletions (insertion 2 and SDL) that distinguish the Pactolus I‐domain from the integrin α I‐domain and β I‐domains. NMR peak exchange broadening is observed due to dimerization, correlating to the β I‐domain and β propeller heterodimerization region within the integrin headpiece. Two unique N‐linked glycosylation sites (Asn151 and Asn230) within this region disrupt dimerization and may account for why Pactolus is not found to associate with an α‐subunit. These changes in quaternary structure, ligand binding loops, glycosylation, and metal sites illustrate how evolution has rapidly and effectively altered key aspects of the integrin β‐subunit to derive a protein of novel function on an existing protein scaffold. Proteins 2007.