Guangyu He

Catalytic hydrogenation of nitrophenols and nitrotoluenes over a palladium/graphene nanocomposite

We report a stable palladium/graphene (Pd/G) nanocomposite with differing Pd content for use in the catalytic hydrogenation of nitrophenols and nitrotoluenes. Various microscopic and spectroscopic techniques were employed to characterize the as-prepared catalysts. Catalytic hydrogenation reactions of nitrophenols were conducted in aqueous solution by adding NaBH4, while the nitrotoluene hydrogenation was carried out in methanol in the presence of H2 because of the poor solubility in water. The Pd/G hybrids exhibited much higher activity and higher stability than the commercial Pd/C. Due to the presence of a large excess of NaBH4 compared to p-nitrophenol, the kinetic data can be explained by the assumption of a pseudo-first-order reaction with regard to p-nitrophenol. The resulting high catalytic activity can be attributed to the graphene sheets’ strong dispersion effect for Pd nanoparticles and good adsorption ability for nitrobenzene derivatives via π–π stacking interactions. A plausible mechanism is proposed. Considering inductive and conjugation effects that may affect the reactions, the reactivity of nitrophenols in this study is expected to follow the order m-NP > o-NP > p-NP > 2,4-DNP > 2,4,6-TNP, which is in good agreement with the experimental results.

Synthesis and characterization of graphene paper with controllable properties via chemical reduction

The synthesis of graphene paper with controllable properties via chemical reduction of exfoliated graphene oxides was investigated. UV-Vis absorption spectra, elemental analysis, FT-IR spectra, X-ray diffraction (XRD), thermo-gravimetric analysis (TGA), mechanical analysis, electrical conductivity and cyclic voltammetry (CV) measurements were applied to the characterization. It was proven that different reduction levels of graphene oxides can significantly alter the thermal, mechanical and electrical properties of the corresponding chemically reduced graphene (CRG) paper. Moreover, UV-vis spectrometry was found to be a valid and facile method to monitor and control the reduction level of CRG, and furthermore to fine tune these properties, which may pave the way for large scale fabrication of graphene-based nanomaterials.

Solvent-thermal preparation of a CuCo2O4/RGO heterocomposite: an efficient catalyst for the reduction of p-nitrophenol

The reduction of a nitro group on the benzene ring is a process of great significance in chemical engineering, as the reduction of p-nitrophenol to p-aminophenol presents a classic example. In this study, a low-cost CuCo2O4/RGO (RGO: reduced graphene oxide) heterocomposite was prepared via the solvent-thermal method to facilitate catalytic reduction of p-nitrophenol, and its properties were investigated by means of XRD, FTIR, TEM and N2 adsorption–desorption measurements. Also, the catalytic activity of the as-synthesized CuCo2O4/RGO composite was investigated in the reduction of p-nitrophenol to p-aminophenol by NaBH4, which achieved complete conversion within 6 min. The CuCo2O4/RGO composite is superior to the current catalysts including some noble metals, in terms of the catalytic activity, recycling stability and cost, which indicated the possibility of realizing the industrial production of p-aminophenol in the future.

A facile novel preparation of three-dimensional Ni@graphene by catalyzed glucose blowing for high-performance supercapacitor electrodes

Three-dimensional Ni@graphene (NG) was prepared for the first time at a low temperature by a one-step facile calcination method. The obtained NG showed a high specific capacitance of 765 F g−1 at a current density of 1 A g−1 and only 5% loss of the initial specific capacitance after 3000 charge–discharge cycles.

Immunostimulatory CpG oligonucleotides form defined three-dimensional structures: results from an NMR study.

The DNA eicosamer 5′‐TCCATGACGTTCCTGATGCT‐3′ is known to stimulate the innate immune system of vertebrae. The immunostimulatory activity is based on the activation of Toll‐like receptor 9 (TLR9). While it is known that the CG dinucleotide of the eicosamer has to be unmethylated, the structural basis of the recognition of the DNA through the receptor remains unclear. Oligodeoxynucleotides containing the sequence of the eicosamer, or a portion thereof, ranging in length from hexamer to pentaeicosamer were studied by 1H NMR spectroscopy. Based on two‐dimensional NMR spectra, a number of resonances could be unambiguously assigned. For all oligonucleotides, structural transitions were detected upon heating, as monitored by the line width and chemical shift of low‐field resonances. This includes the TC dinucleotide of the 5′‐terminal portion, which does not have any clear base‐pairing partners. The melting transitions, together with the NOESY cross‐peaks, demonstrate that structure formation occurs well beyond the core hexamer 5′‐GACGTT‐3′, a fact that may be important for understanding the molecular recognition by the Toll‐like receptors of the innate immune system.

Preparation and characterization of metal-containing aromatic polyimides

A series of novel metal-containing aromatic polyimides were synthesized from divalent metal oxide/hydroxide (MO/M(OH)2) (M = Ba, Sr, Ca, Mg, Zn, Cd, Co, Ni, Pb, Cu), p-aniline sulfonic acid (ASA), and 3,3′-4,4′-benzophenonetetracarboxylic dianhydride (BTDA). The C, H, N, and S contents were determined by elemental analysis, their structures were characterized by proton nuclear magnetic resonance (1H-NMR) and Fourier transform infrared (FT-IR) spectroscopy, and the thermal properties of the polymers were also studied by TG–DTA. It is found that metal-containing polyimides have a higher thermal stability.

ZnO–Bi2O3/graphene oxide photocatalyst with high photocatalytic performance under visible light

Abstract Photocatalytic nanomaterials are attracting more and more attention because of their potential for solving environmental problems. ZnO, as one of the most promising photocatalysts, can only be excited by ultraviolet (UV) or near UV radiation. The objective of the study is to describe an efficient visible light driven ZnO based photocatalyst. In this regard, we communicate the preliminary research on the synthesis, characterisation and photocatalytic properties of ZnO–Bi2O3/graphene oxide (GO) composite materials. It was found that the photodegradation of methylene blue in the presence of ZnO–Bi2O3/GO reached 99·62% after irradiation with visible light for 2 h. The presence of GO enhances the stability of ZnO–Bi2O3 and reduces the recombination of charge carriers. ZnO–Bi2O3/GO also shows high photocatalytic activity for the degradation of acid blue, acid yellow, reactive red, acid red, reactive yellow and reactive blue under visible light irradiation. The novel aspect is the combination of GO and Bi2O3 doped ZnO. The use of GO enhances the efficiency of photocatalysis, and Bi2O3 doping ZnO excites the absorption of visible light. The impact of the research concerns the study of ZnO–Bi2O3/GO, which can be used as a promising photocatalyst for the treatment of textile wastewater.

Photosynthesis of Multiple Valence Silver Nanoparticles on Reduced Graphene Oxide Sheets With Enhanced Antibacterial Activity

Multiple valence silver nanoparticles with irregular shape were anchored on reduced graphene oxide sheets by light irradiation. The characterization analysis revealed silver nanoparticles with different valences were uniformly attached on the surface of reduced graphene oxide sheets and mostly in the size of 30 nm. The antibacterial activities of the as-obtained nanocomposite against gram-negative bacteria E. coli and gram-positive bacteria S. aureus were investigated. Moreover, stability of the nanocomposite was measured by silver ion release. It was found that the nanocomposite has enhanced antibacterial activity and outstanding stability, which makes it a potential antibacterial agent.

One-step hydrothermal synthesis of peony-like Ag/Bi2WO6 as efficient visible light-driven photocatalyst toward organic pollutants degradation

AbstractHere, we report a simple approach to fabricate 3D hierarchical peony-like Ag/Bi2WO6 hybrid photocatalyst through one-step hydrothermal method with l-leucine as a template. The morphology and structure of the resultant materials were characterized by various analytical methods, such as X-ray diffraction, field emission scanning electron microscopy and UV–Vis diffuse reflectance spectra. The photocatalytic performance of Bi2WO6 and Ag/Bi2WO6 samples was evaluated by degrading organic dye and antibiotic in water under visible light irradiation. A series of results indicated that loaded Ag nanoparticles significantly improve the photocatalytic activity of Bi2WO6. In addition, the possible mechanism was proposed that the enhanced photocatalytic activity was resulted from the unique configuration of peony-like morphology that favorable for the adsorption of organic compounds and the high Schottky barriers between interface of Ag NPs and Bi2WO6, which promoted the transfer of photogenerated electrons from Bi2WO6 to Ag NPs. Meanwhile, noble metal Ag can induce surface plasmon resonance leading to the better visible light absorption of Bi2WO6.

Improved ciprofloxacin removal by a Fe(VI)-Fe3O4/graphene system under visible light irradiation

In this paper, Fe3O4/graphene (Fe3O4/GE) nanocomposites were prepared by a co-precipitation method and characterized by X-ray diffraction (XRD), transmission electron microscopy (TEM) and UV-vis diffuse reflectance spectra (UV-vis DRS). The composites were used in combination with Fe(VI) to construct a Fe(VI)-Fe3O4/GE system in order to degrade ciprofloxacin (CIP) in simulated water samples. The photocatalytic properties of Fe(VI)-Fe3O4/GE were evaluated under visible light irradiation. The concentration of CIP in solution was detected by high performance liquid chromatography (HPLC). A series of results showed that Fe(VI), as a good electron capture agent, could significantly improve the treatment performance. Major determining factors during CIP degradation were also investigated, in which solution pH of 9, Fe(VI) to Fe3O4/GE dosage ratio of 1:25 and GE content in the Fe3O4/GE nanocomposites of 10 wt% were found to be the best experimental conditions. The results demonstrated that the Fe(VI)-Fe3O4/GE system could offer an alternative process in water treatment in addition to the current Fe(VI)-UV/TiO2 process.