Guilan Lu

Characteristics of group A Streptococcus strains circulating during scarlet fever epidemic, Beijing, China, 2011.

Scarlet fever is one of a variety of diseases caused by group A Streptococcus (GAS). During 2011, a scarlet fever epidemic characterized by peak monthly incidence rates 2.9–6.7 times higher than those in 2006–2010 occurred in Beijing, China. During the epidemic, hospital-based enhanced surveillance for scarlet fever and pharyngitis was conducted to determine characteristics of circulating GAS strains. The surveillance identified 3,359 clinical cases of scarlet fever or pharyngitis. GAS was isolated from 647 of the patients; 76.4% of the strains were type emm12, and 17.1% were emm1. Almost all isolates harbored superantigens speC and ssa. All isolates were susceptible to penicillin, and resistance rates were 96.1% to erythromycin, 93.7% to tetracycline, and 79.4% to clindamycin. Because emm12 type GAS is not the predominant type in other countries, wider surveillance for the possible spread of emm12 type GAS from China to other countries is warranted.

Serological survey of 2009 H1N1 influenza in residents of Beijing, China.

In order to determine the prevalence of antibody against 2009 H1N1 influenza in Beijing, we conducted a serological survey in 710 subjects, 1 month after the epidemic peak. We found that 13·8% of our cohort was seropositive. Subjects aged ≥60 years recorded the lowest seroprevalence (4·5%). The age-weighted seroprevalence of 14·0% was far lower than the supposed infection rate at the epidemic peak, derived from the basic reproduction number for 2009 H1N1 virus. For subjects who had received the pandemic vaccine seroprevalence was 51·4%. In subjects aged ≥60 years the seasonal influenza vaccination was not significantly associated with being seropositive. Our study suggests that many factors, and not just the immunological level against 2009 H1N1 influenza in the community, affected the spread of the virus within the population of Beijing.

A Serological Survey of Antibodies to H5, H7 and H9 Avian Influenza Viruses amongst the Duck-Related Workers in Beijing, China

The continued spread of highly pathogenic avian influenza (HPAI) viruses of H5 and H7 subtypes and low pathogenic avian influenza (LPAI) viruses of H5, H7 and H9 subtypes in birds and the subsequent infections in humans pose an ongoing pandemic threat. It has been proposed that poultry workers are at higher risk of exposure to HPAI or LPAI viruses and subsequently infection due to their repeated exposure to chickens or domestic waterfowl. The aim of this study was to examine the seroprevalence of antibodies against H5, H7 and H9 viruses amongst duck-related workers in Beijing, China and the risk factors associated with seropositivity. In March, 2011, 1741 participants were recruited from (1) commercial duck-breeding farms; (2) private duck-breeding farms; and (3) duck-slaughtering farms. Local villagers who bred ducks in their backyards were also recruited. A survey was administered by face-to-face interview, and blood samples were collected from subjects for antibody testing against H5, H7 and H9 viruses. We found that none of the subjects were seropositive for either H5 or H7 viruses, and only 0.7% (12/1741) had antibody against H9. A statistically significant difference in H9 antibody seroprevalence existed between the various categories of workers (P = 0.005), with the highest figures recorded amongst the villagers (1.7%). Independent risk factors associated with seropositivity toinfection with H9 virus included less frequent disinfection of worksite (OR, 5.13 [95% CI, 1.07–24.58]; P = 0.041; ≤ twice monthly versus>twice monthly) and handling ducks with wounds on hands (OR, 4.13 [95% CI, 1.26–13.57]; P = 0.019). Whilst the risk of infection with H5, H7 and H9 viruses appears to be low among duck-related workers in Beijing, China, ongoing monitoring of infection with the H9 virus is still warranted, especially amongst villagers who breed backyard ducks to monitor for any changes.

Surveillance for avian influenza A(H7N9), Beijing, China, 2013.

During surveillance for pneumonia of unknown etiology and sentinel hospital–based surveillance in Beijing, China, we detected avian influenza A(H7N9) virus infection in 4 persons who had pneumonia, influenza-like illness, or asymptomatic infections. Samples from poultry workers, associated poultry environments, and wild birds suggest that this virus might not be present in Beijing.

Seroprevalence of pandemic (H1N1) 2009 influenza and effectiveness of 2010/2011 influenza vaccine during 2010/2011 season in Beijing, China

Please cite this paper as: Yang et al. (2011) Seroprevalence of pandemic (H1N1) 2009 influenza and effectiveness of 2010/2011 influenza vaccine during 2010/2011 season in Beijing, China. Influenza and Other Respiratory Viruses 6(6), 381–388.

IFITM3 Rs12252-C Variant Increases Potential Risk for Severe Influenza Virus Infection in Chinese Population.

Background: Interferon Inducible Transmembrane 3 (IFITM3) is a key factor in interferon pathway and it involves hosts immune response against multiple viruses. IFITM3 rs12252-C was associated with severe influenza virus infection in several studies, however whether this association is universal to all types of influenza virus or diverse ethnic populations remain controversial. Method: A case-control genetic association study was performed from September 2013 to April 2014 and September 2014 to April 2015. All samples were tested for influenza using RT-PCR, and genotyped by High Resolution Melting assay. Results: A total of 65 healthy people, 165 mild influenza-like illness (ILI) cases and 315 severe acute respiratory infection (SARI) cases were enrolled in this study. The frequency of CC genotype was much higher in SARI cases with IVI than that in ILI cases with IVI (61.59 vs. 27.16%), leading a 4.67-fold greater risk for severe IVI than other two genotypes. Moreover, the risk of IFITM3 rs12252-C variant for severe IVI was specific for both influenza A and influenza B. Conclusion: IFITM3 rs12252 CC genotype was associated with severity rather than susceptibility of IVI in Chinese population, and this strong effect was observed in all subtypes of seasonal influenza infection.

Avian influenza A(H7N9) and (H5N1) infections among poultry and swine workers and the general population in Beijing, China, 2013–2015

Although several studies have reported seroprevalences of antibody against avian influenza A(H7N9) virus among poultry workers in southern China, results have varied and data in northern China are scarce. To understand risks of H7N9 and H5N1 virus infections in northern China, a serological cohort study was conducted. Poultry workers, swine workers and the general population in Beijing, China, were evaluated through three surveys in November 2013, April 2014 and April 2015. The highest seroprevalence to H7N9 virus among poultry workers was recorded in the April 2014 and April 2015 surveys (0.4%), while that to H5N1 clade 2.3.4 or clade 2.3.2.1 virus was noted in the April 2014 survey (1.6% and 0.2%, respectively). The incidence of H7N9 virus infections among poultry workers (1.6/1000 person-months) was significantly lower than that of H5N1 clade 2.3.4 infections (3.8/1000 person-months) but higher than that of H5N1 clade 2.3.2.1 infections (0.3/1000 person-months). Compared with the general population, poultry workers were at higher risk of contracting H7N9 virus (IRR: 34.90; p < 0.001) or H5N1 clade 2.3.4 virus (IRR: 10.58; p < 0.001). Although risks of H7N9 and H5N1 virus infections remain low in Beijing, continued preventive measures are warranted for poultry workers.

Prevalence of Seasonal Influenza Viruses and Pandemic H1N1 Virus in Beijing from 2008 to 2012

In northern China, influenza circulates on a seasonal and regular basis during the winter-spring season [1]. Our study was conducted in Beijing between November 2008 and March 2012, specifically from November 2008 to March 2009 (period 1), from November 2009 to March 2010 (period 2), from November 2010 to March 2011 (period 3), and from November 2011 to March 2012 (period 4), in order to evaluate the annual incidence rates of influenza and to identify the circulating viral types and subtypes for facilitating the local vaccination programs and regional influenza control. Virological prevalence, the subject of the surveillance, was defined based on the influenza-like illnesses (ILIs) as follows: a temperature of ≥38℃, either cough or sore throat, and no laboratory-confirmed evidence of another disease in patients who presented at the Fever Outpatient Clinic Department of the sentinel hospitals. Over the 4 yr, 6,397 throat swab samples from outpatients with ILIs were collected and tested. The ages of outpatients ranged between 6 months and 91 yr (median, 32 yr; mean, 37.1 yr). Specimens were collected from both female (n=3,338; 52.18%) and male (n=3,059; 47.82%) patients. Total RNA was extracted from 100 µL of each sample using QIAmp Viral RNA Mini kit (QIAGEN, Valencia, CA, USA); subsequently, they were analyzed by real-time (RT) PCR methods for influenza viruses, as recommended by the Chinese National Influenza Center, including seasonal influenza viruses such as FluA(H1N1), FluA(H3N2), FluB, and pdmH1N1 under the same testing conditions and procedures with the exception of the respective primers and probe, i.e., FluA(H1N1)-F, AACATGTTACCCAGGGCATTTCGC; FluA(H1N1)-R, GTGGTTGGGCCATGAGCTTTCTTT; FluA(H1N1)-P, GAGGAACTGAGGGAGCAATTGAGTTCAG; FluA (H3N2)-F, ACCCTCAGTGTGATGGCTTCCAAA; FluA(H3N2)-R, TAAGGGAGGCATAATCCGGCACAT; FluA(H3N2)-P, ACGCAGCAAAGCCTACAGCAACTGT; FluB-F, TCCTCAACTCACTCTTCGAGCG; FluB-R, CGGTGCTCTTGACCAAATTGG; FluB-P, CCAATTCGAGCAGCTGAAACTGCGGTG; pdmH1N1-F, GGGTAGCCCCATTGCAT; pdmH1N1-R, AGAGTGATTCACACTCTGGATTTC; and pdmH1N1-P, TGGGTAAATGTAACATTGCTGGCTGG. Real-time (RT) PCR was performed using AgPath-ID™ One-Step RT-PCR Kit (Applied Biosystems International, Foster City, CA, USA) with an ABI Prism 7500 Taqman machine (Applied Biosystems International). The reaction was conducted at a total volume of 25 µL containing 12.5 µL of 2×RT-PCR buffer, 1 µL of 2×RT-PCR enzyme, 1.67 µL of detection enhancer, 400 nM of each primer, 200 nM of probe, 3.33 µL of double distilled water (ddH2O), and 5 µL of template. Optimized amplification conditions were as follows: 1 cycle of 50℃ for 30 min, followed by 10 min at 95℃, and 45 cycles of 15 sec at 95℃ and 45 sec at 55℃. Influenza viruses were detected in 6,397 clinical samples of outpatients with ILIs at peak times, with varying compositions of influenza numbers. Fluctuating trends were observed in Beijing, China, over the 4 continuous periods. The results of prevalence of common seasonal influenza are summarized in Fig. 1. From period 1 to period 4, the positive prevalence rate of FluA(H1N1) decreased sharply year by year (period 1, 8.12%; period 2, 2.9%; period 3, 0.32%; and period 4, 0%), especially for period 4, where no positive case of FluA(H1N1) was recorded. Conversely, pdmH1N1 gradually replaced FluA(H1N1) from the start of the 2009 epidemics (period 1, 0%; period 2, 25.64%; period 3, 10.71%; and period 4, 4.65%). FluA(H3N2) and FluB also present fluctuating changes in the positive detection rate of the surveillance; they are the predominant viral members of seasonal influenza due to the principle of dominance by competitive circulation, whereby 1 type or subtype of seasonal influenza virus becomes the predominant form while the other types and subtypes of seasonal influenza virus play a secondary role. The predominant positive detection rates over the 4 periods were: FluA(H3N2), 10.88%; pdmH1N1, 25.64%; FluA(H3N2), 12.39%; and FluB, 15.37%. Especially in period 2, the pandemic H1N1 virus has the capacity to suppress seasonal influenza A virus by competitive circulation with multiple factors such as low preexisting immune capacity and stronger infectivity. Conversely, the seasonal peak time was recorded slightly later than the peak time of the previous period. In winter, period 1 and period 2 were the main peak time of seasonal influenza, while in spring it peaked during periods 3 and 4. There were significant differences in the positive rate of surveillance for the same seasonal influenza virus between the 4 detection periods (P<0.01) as well as significant differences for the positive rate of surveillance for 4 types/subtypes of seasonal influenza viruses in the same detection period (P<0.01). Fig. 1 Virological surveillance of influenza during the 4 periods. Bars show the positive number of different seasonal influenza viruses and lines indicate the positive rate of different seasonal influenza viruses detected in 4 periods. Influenza surveillance is an important step in understanding the epidemiology and virology of influenza, while the collection of comprehensive data on the burden of influenza is vital for guiding policy decisions about prevention and control of the influenza virus [2-4]. Our findings propose that vaccination against seasonal influenza should be enhanced; local surveillance advocates the October of every year as the optimal time for influenza vaccination in Beijing in order to ensure maximum level of protection during the seasonal peak times. On the other hand, virology data from Beijing can certainly contribute to a better understanding of the evolution of seasonal influenza viruses globally and is of a major interest, especially for the control of new emerging influenza strains [5-7].

Human Parainfluenza Virus Infection in Severe Acute Respiratory Infection Cases in Beijing, 2014-2016: a Molecular Epidemiological Study

Severe acute respiratory infection (SARI) threatens human health and even survival, causing a huge number of hospitalized patients every year. However, as one of the most common respiratory viruses circulated worldwide, the epidemiological and phylogenetic characteristics of human parainfluenza virus (HPIV) in these cases were not well known.

A case of human infection with avian Influenza A/H7N9 virus in Beijing: virological and serological analysis.

This study described some essential viral and sera-characteristics of A/H7N9 virus infection in a 61-year old case patient. With the antiviral therapy and respiratory support, the patient showed a significant decrease of viral loads from 6.72 log10 copies/mL to 0 in 22 days, and a correlated increase of serum hemagglutination inhibition titers during the same period. Phylogenetic analysis demonstrated that the isolated strain was highly homologous to previous strains isolated in the southeast of China. Drug resistance-associated R292K mutation became detectable 17 days after antiviral therapy, but no remarkable influence on the viral clearance was observed.