Xiaomin Peng

Characteristics of group A Streptococcus strains circulating during scarlet fever epidemic, Beijing, China, 2011.

Scarlet fever is one of a variety of diseases caused by group A Streptococcus (GAS). During 2011, a scarlet fever epidemic characterized by peak monthly incidence rates 2.9–6.7 times higher than those in 2006–2010 occurred in Beijing, China. During the epidemic, hospital-based enhanced surveillance for scarlet fever and pharyngitis was conducted to determine characteristics of circulating GAS strains. The surveillance identified 3,359 clinical cases of scarlet fever or pharyngitis. GAS was isolated from 647 of the patients; 76.4% of the strains were type emm12, and 17.1% were emm1. Almost all isolates harbored superantigens speC and ssa. All isolates were susceptible to penicillin, and resistance rates were 96.1% to erythromycin, 93.7% to tetracycline, and 79.4% to clindamycin. Because emm12 type GAS is not the predominant type in other countries, wider surveillance for the possible spread of emm12 type GAS from China to other countries is warranted.

A Serological Survey of Antibodies to H5, H7 and H9 Avian Influenza Viruses amongst the Duck-Related Workers in Beijing, China

The continued spread of highly pathogenic avian influenza (HPAI) viruses of H5 and H7 subtypes and low pathogenic avian influenza (LPAI) viruses of H5, H7 and H9 subtypes in birds and the subsequent infections in humans pose an ongoing pandemic threat. It has been proposed that poultry workers are at higher risk of exposure to HPAI or LPAI viruses and subsequently infection due to their repeated exposure to chickens or domestic waterfowl. The aim of this study was to examine the seroprevalence of antibodies against H5, H7 and H9 viruses amongst duck-related workers in Beijing, China and the risk factors associated with seropositivity. In March, 2011, 1741 participants were recruited from (1) commercial duck-breeding farms; (2) private duck-breeding farms; and (3) duck-slaughtering farms. Local villagers who bred ducks in their backyards were also recruited. A survey was administered by face-to-face interview, and blood samples were collected from subjects for antibody testing against H5, H7 and H9 viruses. We found that none of the subjects were seropositive for either H5 or H7 viruses, and only 0.7% (12/1741) had antibody against H9. A statistically significant difference in H9 antibody seroprevalence existed between the various categories of workers (P = 0.005), with the highest figures recorded amongst the villagers (1.7%). Independent risk factors associated with seropositivity toinfection with H9 virus included less frequent disinfection of worksite (OR, 5.13 [95% CI, 1.07–24.58]; P = 0.041; ≤ twice monthly versus>twice monthly) and handling ducks with wounds on hands (OR, 4.13 [95% CI, 1.26–13.57]; P = 0.019). Whilst the risk of infection with H5, H7 and H9 viruses appears to be low among duck-related workers in Beijing, China, ongoing monitoring of infection with the H9 virus is still warranted, especially amongst villagers who breed backyard ducks to monitor for any changes.

Surveillance for avian influenza A(H7N9), Beijing, China, 2013.

During surveillance for pneumonia of unknown etiology and sentinel hospital–based surveillance in Beijing, China, we detected avian influenza A(H7N9) virus infection in 4 persons who had pneumonia, influenza-like illness, or asymptomatic infections. Samples from poultry workers, associated poultry environments, and wild birds suggest that this virus might not be present in Beijing.

Seroprevalence of pandemic (H1N1) 2009 influenza and effectiveness of 2010/2011 influenza vaccine during 2010/2011 season in Beijing, China

Please cite this paper as: Yang et al. (2011) Seroprevalence of pandemic (H1N1) 2009 influenza and effectiveness of 2010/2011 influenza vaccine during 2010/2011 season in Beijing, China. Influenza and Other Respiratory Viruses 6(6), 381–388.

Using an adjusted Serfling regression model to improve the early warning at the arrival of peak timing of influenza in Beijing.

Serfling-type periodic regression models have been widely used to identify and analyse epidemic of influenza. In these approaches, the baseline is traditionally determined using cleaned historical non-epidemic data. However, we found that the previous exclusion of epidemic seasons was empirical, since year-year variations in the seasonal pattern of activity had been ignored. Therefore, excluding fixed ‘epidemic’ months did not seem reasonable. We made some adjustments in the rule of epidemic-period removal to avoid potentially subjective definition of the start and end of epidemic periods. We fitted the baseline iteratively. Firstly, we established a Serfling regression model based on the actual observations without any removals. After that, instead of manually excluding a predefined ‘epidemic’ period (the traditional method), we excluded observations which exceeded a calculated boundary. We then established Serfling regression once more using the cleaned data and excluded observations which exceeded a calculated boundary. We repeated this process until the R2 value stopped to increase. In addition, the definitions of the onset of influenza epidemic were heterogeneous, which might make it impossible to accurately evaluate the performance of alternative approaches. We then used this modified model to detect the peak timing of influenza instead of the onset of epidemic and compared this model with traditional Serfling models using observed weekly case counts of influenza-like illness (ILIs), in terms of sensitivity, specificity and lead time. A better performance was observed. In summary, we provide an adjusted Serfling model which may have improved performance over traditional models in early warning at arrival of peak timing of influenza.

A probable food-borne outbreak of pharyngitis after a massive rainstorm in Beijing, caused by emm89 group A Streptococcus rarely found in China

On July 28, 2012, it was reported that over 20 members of staff of a film crew with pharyngitis visited a hospital in Beijing, China. We conducted a rapid investigation of this outbreak. From July 8, 2012, this film crew with 140 members of staff settled in a town, Beijing to make a film. Their accommodation and food were provided by local vendors. On July 21, the area where the film crew was located was hit by an unprecedented massive rainstorm in Beijing, and the provision of domestic water was compromised. Twenty-eight pharyngitis cases were identified in this outbreak, and the attack rate was 20% (28/140). The date of illness onset of the 28 cases was between midday of July 26 and midday of July 27. Eight group A Streptococcus (GAS) isolates were recovered from pharyngeal swabs of 15 cases. All the isolates belonged to emm89 by emm typing, with resistance to erythromycin, clindamycin, and tetracycline. The onset of illness for the cases in this GAS pharyngitis outbreak fell within a 24-h period and there were no secondary cases in the following 7 days even though no isolation measures were taken and shooting of the film continued, which suggested that this outbreak might have derived from a common-source exposure. As a rainstorm preceding the outbreak influenced the provision of domestic water in the area where the film crew were resident, the probability of contamination of their food was increased. Therefore, we presumed that this might be a food-borne outbreak. Food-borne outbreaks of GAS pharyngitis have been reported in many countries, but not in China. This outbreak was caused by emm89 GAS, rarely found in China. However, emm89 GAS has been one of the most predominant emm types in invasive GAS infections in European countries, and a marked expansion of emm89 strains has occurred in Canada. All emm89 isolates in this study were resistant to erythromycin, clindamycin, and tetracycline, which is rare in other countries. This is the first probable food-borne outbreak of GAS pharyngitis reported in China. Given the possible role of the rainstorm in this outbreak, it is suggested that not only enteric diseases, but respiratory diseases should be closely monitored after a rainstorm. In light of the circulation of emm89 GAS in many countries and this outbreak being caused by emm89, ongoing surveillance of emm89 GAS is warranted in China, and changes to water purification and food preparation should be considered after a rainstorm.

IFITM3 Rs12252-C Variant Increases Potential Risk for Severe Influenza Virus Infection in Chinese Population.

Background: Interferon Inducible Transmembrane 3 (IFITM3) is a key factor in interferon pathway and it involves hosts immune response against multiple viruses. IFITM3 rs12252-C was associated with severe influenza virus infection in several studies, however whether this association is universal to all types of influenza virus or diverse ethnic populations remain controversial. Method: A case-control genetic association study was performed from September 2013 to April 2014 and September 2014 to April 2015. All samples were tested for influenza using RT-PCR, and genotyped by High Resolution Melting assay. Results: A total of 65 healthy people, 165 mild influenza-like illness (ILI) cases and 315 severe acute respiratory infection (SARI) cases were enrolled in this study. The frequency of CC genotype was much higher in SARI cases with IVI than that in ILI cases with IVI (61.59 vs. 27.16%), leading a 4.67-fold greater risk for severe IVI than other two genotypes. Moreover, the risk of IFITM3 rs12252-C variant for severe IVI was specific for both influenza A and influenza B. Conclusion: IFITM3 rs12252 CC genotype was associated with severity rather than susceptibility of IVI in Chinese population, and this strong effect was observed in all subtypes of seasonal influenza infection.

Avian influenza A(H7N9) and (H5N1) infections among poultry and swine workers and the general population in Beijing, China, 2013–2015

Although several studies have reported seroprevalences of antibody against avian influenza A(H7N9) virus among poultry workers in southern China, results have varied and data in northern China are scarce. To understand risks of H7N9 and H5N1 virus infections in northern China, a serological cohort study was conducted. Poultry workers, swine workers and the general population in Beijing, China, were evaluated through three surveys in November 2013, April 2014 and April 2015. The highest seroprevalence to H7N9 virus among poultry workers was recorded in the April 2014 and April 2015 surveys (0.4%), while that to H5N1 clade 2.3.4 or clade 2.3.2.1 virus was noted in the April 2014 survey (1.6% and 0.2%, respectively). The incidence of H7N9 virus infections among poultry workers (1.6/1000 person-months) was significantly lower than that of H5N1 clade 2.3.4 infections (3.8/1000 person-months) but higher than that of H5N1 clade 2.3.2.1 infections (0.3/1000 person-months). Compared with the general population, poultry workers were at higher risk of contracting H7N9 virus (IRR: 34.90; p < 0.001) or H5N1 clade 2.3.4 virus (IRR: 10.58; p < 0.001). Although risks of H7N9 and H5N1 virus infections remain low in Beijing, continued preventive measures are warranted for poultry workers.

Prevalence of Seasonal Influenza Viruses and Pandemic H1N1 Virus in Beijing from 2008 to 2012

In northern China, influenza circulates on a seasonal and regular basis during the winter-spring season [1]. Our study was conducted in Beijing between November 2008 and March 2012, specifically from November 2008 to March 2009 (period 1), from November 2009 to March 2010 (period 2), from November 2010 to March 2011 (period 3), and from November 2011 to March 2012 (period 4), in order to evaluate the annual incidence rates of influenza and to identify the circulating viral types and subtypes for facilitating the local vaccination programs and regional influenza control. Virological prevalence, the subject of the surveillance, was defined based on the influenza-like illnesses (ILIs) as follows: a temperature of ≥38℃, either cough or sore throat, and no laboratory-confirmed evidence of another disease in patients who presented at the Fever Outpatient Clinic Department of the sentinel hospitals. Over the 4 yr, 6,397 throat swab samples from outpatients with ILIs were collected and tested. The ages of outpatients ranged between 6 months and 91 yr (median, 32 yr; mean, 37.1 yr). Specimens were collected from both female (n=3,338; 52.18%) and male (n=3,059; 47.82%) patients. Total RNA was extracted from 100 µL of each sample using QIAmp Viral RNA Mini kit (QIAGEN, Valencia, CA, USA); subsequently, they were analyzed by real-time (RT) PCR methods for influenza viruses, as recommended by the Chinese National Influenza Center, including seasonal influenza viruses such as FluA(H1N1), FluA(H3N2), FluB, and pdmH1N1 under the same testing conditions and procedures with the exception of the respective primers and probe, i.e., FluA(H1N1)-F, AACATGTTACCCAGGGCATTTCGC; FluA(H1N1)-R, GTGGTTGGGCCATGAGCTTTCTTT; FluA(H1N1)-P, GAGGAACTGAGGGAGCAATTGAGTTCAG; FluA (H3N2)-F, ACCCTCAGTGTGATGGCTTCCAAA; FluA(H3N2)-R, TAAGGGAGGCATAATCCGGCACAT; FluA(H3N2)-P, ACGCAGCAAAGCCTACAGCAACTGT; FluB-F, TCCTCAACTCACTCTTCGAGCG; FluB-R, CGGTGCTCTTGACCAAATTGG; FluB-P, CCAATTCGAGCAGCTGAAACTGCGGTG; pdmH1N1-F, GGGTAGCCCCATTGCAT; pdmH1N1-R, AGAGTGATTCACACTCTGGATTTC; and pdmH1N1-P, TGGGTAAATGTAACATTGCTGGCTGG. Real-time (RT) PCR was performed using AgPath-ID™ One-Step RT-PCR Kit (Applied Biosystems International, Foster City, CA, USA) with an ABI Prism 7500 Taqman machine (Applied Biosystems International). The reaction was conducted at a total volume of 25 µL containing 12.5 µL of 2×RT-PCR buffer, 1 µL of 2×RT-PCR enzyme, 1.67 µL of detection enhancer, 400 nM of each primer, 200 nM of probe, 3.33 µL of double distilled water (ddH2O), and 5 µL of template. Optimized amplification conditions were as follows: 1 cycle of 50℃ for 30 min, followed by 10 min at 95℃, and 45 cycles of 15 sec at 95℃ and 45 sec at 55℃. Influenza viruses were detected in 6,397 clinical samples of outpatients with ILIs at peak times, with varying compositions of influenza numbers. Fluctuating trends were observed in Beijing, China, over the 4 continuous periods. The results of prevalence of common seasonal influenza are summarized in Fig. 1. From period 1 to period 4, the positive prevalence rate of FluA(H1N1) decreased sharply year by year (period 1, 8.12%; period 2, 2.9%; period 3, 0.32%; and period 4, 0%), especially for period 4, where no positive case of FluA(H1N1) was recorded. Conversely, pdmH1N1 gradually replaced FluA(H1N1) from the start of the 2009 epidemics (period 1, 0%; period 2, 25.64%; period 3, 10.71%; and period 4, 4.65%). FluA(H3N2) and FluB also present fluctuating changes in the positive detection rate of the surveillance; they are the predominant viral members of seasonal influenza due to the principle of dominance by competitive circulation, whereby 1 type or subtype of seasonal influenza virus becomes the predominant form while the other types and subtypes of seasonal influenza virus play a secondary role. The predominant positive detection rates over the 4 periods were: FluA(H3N2), 10.88%; pdmH1N1, 25.64%; FluA(H3N2), 12.39%; and FluB, 15.37%. Especially in period 2, the pandemic H1N1 virus has the capacity to suppress seasonal influenza A virus by competitive circulation with multiple factors such as low preexisting immune capacity and stronger infectivity. Conversely, the seasonal peak time was recorded slightly later than the peak time of the previous period. In winter, period 1 and period 2 were the main peak time of seasonal influenza, while in spring it peaked during periods 3 and 4. There were significant differences in the positive rate of surveillance for the same seasonal influenza virus between the 4 detection periods (P<0.01) as well as significant differences for the positive rate of surveillance for 4 types/subtypes of seasonal influenza viruses in the same detection period (P<0.01). Fig. 1 Virological surveillance of influenza during the 4 periods. Bars show the positive number of different seasonal influenza viruses and lines indicate the positive rate of different seasonal influenza viruses detected in 4 periods. Influenza surveillance is an important step in understanding the epidemiology and virology of influenza, while the collection of comprehensive data on the burden of influenza is vital for guiding policy decisions about prevention and control of the influenza virus [2-4]. Our findings propose that vaccination against seasonal influenza should be enhanced; local surveillance advocates the October of every year as the optimal time for influenza vaccination in Beijing in order to ensure maximum level of protection during the seasonal peak times. On the other hand, virology data from Beijing can certainly contribute to a better understanding of the evolution of seasonal influenza viruses globally and is of a major interest, especially for the control of new emerging influenza strains [5-7].

Human Parainfluenza Virus Infection in Severe Acute Respiratory Infection Cases in Beijing, 2014-2016: a Molecular Epidemiological Study

Severe acute respiratory infection (SARI) threatens human health and even survival, causing a huge number of hospitalized patients every year. However, as one of the most common respiratory viruses circulated worldwide, the epidemiological and phylogenetic characteristics of human parainfluenza virus (HPIV) in these cases were not well known.