Helen J. Eyre

Fc alpha/mu receptor mediates endocytosis of IgM-coated microbes

IgM is the first antibody to be produced in a humoral immune response and plays an important role in the primary stages of immunity. Here we describe a mouse Fc receptor, designated Fcα/μR, and its human homolog, that bind both IgM and IgA with intermediate or high affinity. Fcα/μR is constitutively expressed on the majority of B lymphocytes and macrophages. Cross-linking Fcα/μR expressed on a pro-B cell line Ba/F3 transfectant with soluble IgM or IgM-coated microparticles induced internalization of the receptor. Fcα/μR also mediated primary B lymphocyte endocytosis of IgM-coated Staphylococcus aureus. Thus, Fcα/μR is involved in the primary stages of the immune response to microbes.

MUC13, a Novel Human Cell Surface Mucin Expressed by Epithelial and Hemopoietic Cells

Transmembrane mucins are glycoproteins involved in barrier function in epithelial tissues. To identify novel transmembrane mucin genes, we performed a tblastn search of the GenBank™ EST data bases with a serine/threonine-rich search string, and a rodent gene expressed in bone marrow was identified. We determined the cDNA sequence of the human orthologue of this gene,MUC13, which localizes to chromosome band 3q13.3 and generates 3.2-kilobase pair transcripts encoding a 512-amino acid protein comprised of an N-terminal mucin repeat domain, three epidermal growth factor-like sequences, a SEA module, a transmembrane domain, and a cytoplasmic tail (GenBank™ accession no. AF286113).MUC13 mRNA is expressed most highly in the large intestine and trachea, and at moderate levels in the kidney, small intestine, appendix, and stomach. In situ hybridization in murine tissues revealed expression in intestinal epithelial and lymphoid cells. Immunohistochemistry demonstrated the human MUC13 protein on the apical membrane of both columnar and goblet cells in the gastrointestinal tract, as well as within goblet cell thecae, indicative of secretion in addition to presence on the cell surface. MUC13 is cleaved, and the β-subunit containing the cytoplasmic tail undergoes homodimerization. Including MUC13, there are at least five cell surface mucins expressed in the gastrointestinal tract.

Human Chromosomal Fragile Site FRA16B Is an Amplified AT-Rich Minisatellite Repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)n trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Identification of SOX3 as an XX male sex reversal gene in mice and humans

Sex in mammals is genetically determined and is defined at the cellular level by sex chromosome complement (XY males and XX females). The Y chromosome-linked gene sex-determining region Y (SRY) is believed to be the master initiator of male sex determination in almost all eutherian and metatherian mammals, functioning to upregulate expression of its direct target gene Sry-related HMG box-containing gene 9 (SOX9). Data suggest that SRY evolved from SOX3, although there is no direct functional evidence to support this hypothesis. Indeed, loss-of-function mutations in SOX3 do not affect sex determination in mice or humans. To further investigate Sox3 function in vivo, we generated transgenic mice overexpressing Sox3. Here, we report that in one of these transgenic lines, Sox3 was ectopically expressed in the bipotential gonad and that this led to frequent complete XX male sex reversal. Further analysis indicated that Sox3 induced testis differentiation in this particular line of mice by upregulating expression of Sox9 via a similar mechanism to Sry. Importantly, we also identified genomic rearrangements within the SOX3 regulatory region in three patients with XX male sex reversal. Together, these data suggest that SOX3 and SRY are functionally interchangeable in sex determination and support the notion that SRY evolved from SOX3 via a regulatory mutation that led to its de novo expression in the early gonad.

Characterization of the human Omega class glutathione transferase genes and associated polymorphisms.

The Omega class glutathione transferases (GSTs) have been identified in many organisms, including human, mouse, rat, pig, Caenorhabditis eglands and Drosophila melanogaster. These GSTs have poor activity with common GST substrates, but exhibit novel glutathione-dependent thioltransferase, dehydroascorbate reductase and monomethylarsonate reductase activities, and modulate Ca release by ryanodine receptors. An investigation of the genomic organization of human GSTO1 identified a second actively transcribed member of the Omega class (GSTO1). Both GSTO1 and GSTO2 are composed of six exons and are separated by 7.5 kb on chromosome 10q24.3. A third sequence that appears to be a reverse-transcribed pseudogene (GSTO3p) has been identified on chromosome 3. GSTO2 has 64% amino acid identity with GSTO1 and conserves the cysteine residue at position 32, which is thought to be important in the active site of GSTO1. Expression of GSTO2 mRNA was seen in a range of tissues, including the liver, kidney, skeletal muscle and prostate. The strongest GSTO2 expression was in the testis, which also expresses a larger transcript than other tissues. Characterization of recombinant GSTO2 has been limited by its poor solubility. Two functional polymorphisms of GSTO1 have been identified. One alters a splice junction and causes the deletion of E155 and another results in an A140D substitution. Characterization of these variants revealed that the A140D substitution affects neither heat stability, nor activity towards 1-chloro-2,4-dinitrobenzene or hydroxyethyl disulphide. In contrast, deletion of residue E155 appears to contribute towards both a loss of heat stability and increased enzymatic activity.

Gene structure alternative splicing, and chromosomal localization of pro-apoptotic Bcl-2 relative Bim.

Abstract. Bim is a proapoptotic protein of the Bcl-2 family that shares only the short BH3 domain with other members. It has three isoforms, apparently produced by alternative splicing. The demonstration that Bim is essential for certain apoptotic responses and to prevent overproduction of hematopoietic cells suggests that it may be a tumor suppressor. We have, therefore, investigated the organization of the mouse Bim gene, delineating its promoter and splicing, and positioned the gene on both mouse and human chromosomes. Bim has six exons, but the third is a facultative intron that is spliced out in the mRNAs for the smaller isoforms (BimL and BimS), but not that encoding the largest isoform (BimEL). The 0.8-kb region 5′ to exon 1, which contains a TATA-less promoter and binding sites for several transcription factors, can drive expression of a reporter gene. Mouse Bim localizes to the distal third of Chromosome (Chr) 2, near the F-G boundary, and its human counterpart to Chr 2q12 or q13. Deletions of these bands have been reported in ten tumors (eight hematopoietic), reinforcing the possibility that Bim is a tumor suppressor. These findings should help to clarify the regulation of Bim expression and to assess whether mutations involving Bim contribute to neoplastic and other diseases.

A novel epithelial-expressed ETS gene, ELF3: human and murine cDNA sequences, murine genomic organization, human mapping to 1q32.2 and expression in tissues and cancer.

The ETS family of genes are implicated in cancers such as Ewings sarcoma, acute myeloid leukemia and chronic myelomoncytic leukemia. Further, they have important functions in embryonic development. Hence, identification and characterization of members of this family are important. We identify a novel ETS family member, ELF3, and report its human and murine cDNA sequences. The mouse cDNA has an alternatively spliced transcript with an extra 60 bp inserted. Hence we present the organization of the murine Elf3 gene together with its exon/intron structure. This gene consists of 9 exons and 8 introns spanning 4.8 kb. ELF3 binds and transactivates ETS sequences and interestingly also shows the ability to bind a GGAT-like purine core, a preferential ETS1/ETS2 type binding site. The expression of ELF3, unlike most other ETS family members, is absent in hematopoietic cells and hematopoietic organs in humans and mice. Intriguingly, the gene is specifically expressed in cell lines of epithelial origin and in organs such as lung, stomach, intestine, kidney that have specialized epithelial cells. We localize the human gene to 1q32.2, a region that is amplified in epithelial tumors of the breast, lung and prostate. Finally, we show that ELF3 expression is increased in a lung carcinoma and adenocarcinoma, as compared to normal tissue. ELF3 is also expressed in cell lines derived from lung cancers. These results suggest that this novel ETS gene may be involved in lung tumorigenesis.

The de novo chromosome 16 translocations of two patients with abnormal phenotypes (mental retardation and epilepsy) disrupt the A2BP1 gene

AbstractThe 16p13.3 breakpoints of two de novo translocations of chromosome 16, t(1;16) and t(14;16), were shown by initial mapping studies to have physically adjacent breakpoints. The translocations were ascertained in patients with abnormal phenotypes characterized by predominant epilepsy in one patient and mental retardation in the other. Distamycin/DAPI banding showed that the chromosome 1 breakpoint of the t(1;16) was in the pericentric heterochromatin therefore restricting potential gene disruption to the 16p13.3 breakpoint. The breakpoints of the two translocations were localized to a region of 3.5 and 115 kb respectively and were approximately 900 kb apart. The mapping was confirmed by fluorescence in situ hybridization (FISH) of clones that spanned the breakpoints to metaphase spreads derived from the patients. The mapping data showed both translocations disrupted the ataxin-2-binding protein 1 (A2BP1) gene that encompasses a large genomic region of 1.7 Mb. A2BP1 encodes a protein that is known to interact with the spinocerebellar ataxia type 2 (SCA2) protein. It is proposed that disruption of the A2BP1 gene is a cause of the abnormal phenotype of the two patients. Ninety-six patients with sporadic epilepsy and 96 female patients with mental retardation were screened by SSCP for potential mutations of A2BP1. No mutations were found, suggesting that disruption of the A2BP1 gene is not a common cause of sporadic epilepsy or mental retardation.

FRA10B Structure Reveals Common Elements in Repeat Expansion and Chromosomal Fragile Site Genesis

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich approximately 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded approximately 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

High-Resolution Cytogenetic-Based Physical Map of Human Chromosome 16

A panel of 54 mouse/human somatic cell hybrids, each possessing various portions of chromosome 16, was constructed; 46 were constructed from naturally occurring rearrangements of this chromosome, which were ascertained in clinical cytogenetics laboratories, and a further 8 from rearrangements spontaneously arising during tissue culture. By mapping 235 DNA markers to this panel of hybrids, and in relation to four fragile sites and the centromere, a cytogenetic-based physical map of chromosome 16 with an average resolution of 1.6 Mb was generated. Included are 66 DNA markers that have been typed in the CEPH pedigrees, and these will allow the construction of a detailed correlation of the cytogenetic-based physical map and the genetic map of this chromosome. Cosmids from chromosome 16 that have been assembled into contigs by use of repetitive sequence fingerprinting have been mapped to the hybrid panel. Approximately 11% of the euchromatin is now both represented in such contigs and located on the cytogenetic-based physical map. This high-resolution cytogenetic-based physical map of chromosome 16 will provide the basis for the cloning of genetically mapped disease genes, genes disrupted in cytogenetic rearrangements that have produced abnormal phenotypes, and cancer breakpoints.