Robert I. Richards

Ancient missense mutations in a new member of the RoRet gene family are likely to cause Familial Mediterranean Fever

Familial Mediterranean fever (FMF) is a recessively inherited disorder characterized by dramatic episodes of fever and serosal inflammation. This report describes the cloning of the gene likely to cause FMF from a 115-kb candidate interval on chromosome 16p. Three different missense mutations were identified in affected individuals, but not in normals. Haplotype and mutational analyses disclosed ancestral relationships among carrier chromosomes in populations that have been separated for centuries. The novel gene encodes a 3.7-kb transcript that is almost exclusively expressed in granulocytes. The predicted protein, pyrin, is a member of a family of nuclear factors homologous to the Ro52 autoantigen. The cloning of the FMF gene promises to shed light on the regulation of acute inflammatory responses.Familial Mediterranean fever (FMF) is a recessively inherited disorder characterized by dramatic episodes of fever and serosal inflammation. This report describes the cloning of the gene likely to cause FMF from a 115-kb candidate interval on chromosome 16p. Three different missense mutations were identified in affected individuals, but not in normals. Haplotype and mutational analyses disclosed ancestral relationships among carrier chromosomes in populations that have been separated for centuries. The novel gene encodes a 3.7-kb transcript that is almost exclusively expressed in granulocytes. The predicted protein, pyrin, is a member of a family of nuclear factors homologous to the Ro52 autoantigen. The cloning of the FMF gene promises to shed light on the regulation of acute inflammatory responses.

Mapping of DNA instability at the fragile X to a trinucleotide repeat sequence p(CCG)n

The sequence of a Pst I restriction fragment was determined that demonstrate instability in fragile X syndrome pedigrees. The region of instability was localized to a trinucleotide repeat p(CCG)n. The sequence flanking this repeat were identical in normal and affected individuals. The breakpoints in two somatic cell hybrids constructed to break at the fragile site also mapped to this repeat sequence. The repeat exhibits instability both when cloned in a nonhomologous host and after amplification by the polymerase chain reaction. These results suggest variation in the trinucleotide repeat copy number as the molecular basis for the instability and possibly the fragile site. This would account for the observed properties of this region in vivo and in vitro.

Structural and functional analysis of the human metallothionein-IA gene: Differential induction by metal ions and glucocorticoids

We describe a region of human DNA containing four metallothionein (hMT) genes. One of these genes, hMT-IA, was found to encode a functional protein that confers heavy metal resistance to NIH 3T3 cells after transfer on a bovine papilloma virus-derived vector. This gene is expressed in cultured human cell lines, but at a lower basal level than the hMT-IIA gene; it shows a different induction response to heavy metals and glucocorticoids than the hMT-IIA gene. Induction of the human MT family therefore does not represent an equivalent elevation in the level of expression of individual genes, but is the sum of the differential responses of active members. The differential response is due to functional differences of the respective promoter/regulatory regions of the genes as shown by gene-fusion experiments. While the hMT-IIA promoter is responsive to Cd++, Zn++, and glucocorticoids, the hMT-IA promoter mediates response only to Cd++.

Fragile and unstable chromosomes in cancer: causes and consequences

Cancer cells commonly exhibit various forms of genetic instability, such as changes in chromosome copy number, translocations and point mutations in particular genes. Although transmissible change seems to be an essential part of the neoplastic process, the extent to which DNA instability is a cause rather than a consequence of cancer is unclear. Chromosomal fragile sites have been proposed to be not only susceptible to DNA instability in cancer cells, but also associated with genes that contribute to the neoplastic process. Mutation at fragile site loci might therefore have a causative role in cancer. Recent studies on one class of human chromosomal fragile sites show that instability at fragile site loci can functionally contribute to tumor cell biology.

Human Chromosomal Fragile Site FRA16B Is an Amplified AT-Rich Minisatellite Repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)n trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Human metallothionein genes: Structure of the functional locus at 16q13

The functional human metallothionein (MT) genes are located on chromosome 16q13. We have physically mapped the functional human MT locus by isolation and restriction digest mapping of cloned DNA. The mapped region contains all sequences on chromosome 16 that hybridize to metallothionein gene probes and comprises 14 tightly linked MT genes, 6 of which have not been previously described. This analysis defines the genetic limits of metallothionein functional diversity in the human genome.

Fragile sites still breaking.

Rare fragile sites on chromosomes are the archetypal dynamic mutations. They involve large expansions of the microsatellite CCG or AT-rich minisatellites. The mutation process is an increase in repeat-unit number from within a normal range, through a premutation range, up to full mutation where the fragile site is expressed. Full mutations can inactivate genes and are regions of genomic instability. Common fragile sites, in particular, might have a role in oncogensis by facilitating gene inactivation through chromosomal deletion or amplification, but this requires further exploration. The mechanisms behind the changes that give rise to the cytogenetic manifestation of chromosomal fragility are now beginning to be understood.

Mutations of the gene encoding the transmembrane transporter protein ABC-C6 cause pseudoxanthoma elasticum

Abstract. We recently published the precise chromosomal localization on chromosome 16p13.1 of the genetic defect underlying pseudoxanthoma elasticum (PXE), an inherited disorder characterized by progressive calcification of elastic fibers in skin, eye, and the cardiovascular system. Here we report the identification of mutations in the gene encoding the transmembrane transporter protein, ABC-C6 (also known as MRP-6), one of the four genes located in the region of linkage, as cause of the disease. Sequence analysis in four independent consanguineous families from Switzerland, Mexico, and South Africa and in one non-consanguineous family from the United States demonstrated several different mis-sense mutations to cosegregate with the disease phenotype. These findings are consistent with the conclusion that PXE is a recessive disorder that displays allelic heterogeneity, which may explain the considerable phenotypic variance characteristic of the disorder.

Fragile X syndrome: genetic localisation by linkage mapping of two microsatellite repeats FRAXAC1 and FRAXAC2 which immediately flank the fragile site.

We report the genetic localisation of the fragile site at Xq27.3 associated with fragile X syndrome. The position of the fragile site within the multipoint linkage map was determined using two polymorphic microsatellite AC repeat markers FRAXAC1 and FRAXAC2. These markers were physically located within 10 kilobases and on either side of the p(CCG)n repeat responsible for the fragile site. FRAXAC1 has five alleles with heterozygosity of 44% and is in strong linkage disequilibrium with FRAXAC2 which has eight alleles and a heterozygosity of 71%. No recombination was observed either between these markers in 40 normal CEPH pedigrees or with the fragile X in affected pedigrees. These markers provide the means for accurate diagnosis of the fragile X genotype in families by rapid polymerase chain reaction analysis and were used to position the fragile X within the multipoint map of the X chromosome to a position 3.7 cM distal to DXS297 and 1.2 cM proximal to DXS296.

The molecular basis of fragile sites in human chromosomes

Fragile sites on chromosomes have been classified into a number of groups according to their frequency and the conditions required to induce them. A number of the rare folate-sensitive fragile sites have been characterized and shown to be amplified methylated CCG trinucleotide repeats. One common fragile site has been partly characterized and appears to be a region of fragility, rather than a single site.