Hidehisa Yoshimura

Genomic structure of an economically important cyanobacterium, Arthrospira (Spirulina) platensis NIES-39.

A filamentous non-N2-fixing cyanobacterium, Arthrospira (Spirulina) platensis, is an important organism for industrial applications and as a food supply. Almost the complete genome of A. platensis NIES-39 was determined in this study. The genome structure of A. platensis is estimated to be a single, circular chromosome of 6.8 Mb, based on optical mapping. Annotation of this 6.7 Mb sequence yielded 6630 protein-coding genes as well as two sets of rRNA genes and 40 tRNA genes. Of the protein-coding genes, 78% are similar to those of other organisms; the remaining 22% are currently unknown. A total 612 kb of the genome comprise group II introns, insertion sequences and some repetitive elements. Group I introns are located in a protein-coding region. Abundant restriction-modification systems were determined. Unique features in the gene composition were noted, particularly in a large number of genes for adenylate cyclase and haemolysin-like Ca2+-binding proteins and in chemotaxis proteins. Filament-specific genes were highlighted by comparative genomic analysis.

Screening for the target gene of cyanobacterial cAMP receptor protein SYCRP1

The target genes for SYCRP1, a cyanobacterial cAMP receptor protein, were surveyed using a DNA micro‐array method. Total RNAs were extracted from a wild‐type strain and a sycrp1 disruptant of Synechocystis sp. PCC 6803, and the respective gene expression levels were compared. The expression levels of six genes (slr1667, slr1668, slr2015, slr2016, slr2017 and slr2018) were clearly decreased by the disruption of the sycrp1 gene. The data suggest that slr1667 and slr1668 constitute one operon and the other four genes constitute another operon. Transcription start points for the first genes of these putative operons, which are slr1667 and slr2015, were determined by primer extension experiments. Gel mobility shift assays and DNase I footprint analyses were carried out to explore the binding of SYCRP1 to the putative promoter regions of slr1667 and slr2015. SYCRP1 bound to the specific site in the 5′ upstream region of slr1667 from positions –170 to –155 relative to the transcription start point, while it did not bind to the 5′ upstream region of slr2015. It was concluded that SYCRP1 regulates the expression of the slr1667 gene directly by binding to a specific site in its promoter.

Group 3 sigma factor gene, sigJ, a key regulator of desiccation tolerance, regulates the synthesis of extracellular polysaccharide in cyanobacterium Anabaena sp. strain PCC 7120

Abstract The changes in the expression of sigma factor genes during dehydration in terrestrial Nostoc HK-01 and aquatic Anabaena PCC 7120 were determined. The expression of the sigJ gene in terrestrial Nostoc HK-01, which is homologous to sigJ (alr0277) in aquatic Anabaena PCC 7120, was significantly induced in the mid-stage of dehydration. We constructed a higher-expressing transformant of the sigJ gene (HE0277) in Anabaena PCC 7120, and the transformant acquired desiccation tolerance. The results of Anabaena oligonucleotide microarray experiments showed that a comparatively large number of genes relating to polysaccharide biosynthesis were upregulated in the HE0277 cells. The extracellular polysaccharide released into the culture medium of the HE0277 cells was as much as 3.2-fold more than that released by the control cells. This strongly suggests that the group 3 sigma factor gene sigJ is fundamental and conducive to desiccation tolerance in these cyanobacteria.

AnCrpA, a cAMP receptor protein, regulates nif-related gene expression in the cyanobacterium Anabaena sp. strain PCC 7120 grown with nitrate

Target genes for a cAMP receptor protein, AnCrpA, were screened using an Anabaena oligonucleotide microarray and real‐time quantitative reverse transcription polymerase chain reaction (RT‐PCR) analysis. Several gene expressions, including some involved in nitrogen fixation, were downregulated in the ancrpA disruptant when cells were grown with nitrate. Electrophoretic mobility shift assays (EMSAs) revealed that AnCrpA bound to the 5′ upstream region of nifB, all1439, hesA, all5347, hglE and coxBII in the presence of cAMP, and all of them are related with nitrogen fixation. A possible AnCrpA‐binding site in the 5′ upstream region of nifB was predicted using hidden Markov model (HMM) software based on the result of in vitro selection of AnCrpA‐binding sequences, and the binding was confirmed by EMSA. Thus, AnCrpA regulates the expressions of gene clusters related to nitrogen fixation in the presence of nitrate.

CccS and CccP are Involved in Construction of Cell Surface Components in the Cyanobacterium Synechocystis sp. strain PCC 6803

We have previously identified two target genes (slr1667 and slr1668) for transcriptional regulation by a cAMP receptor protein, SYCRP1, in a cAMP-dependent manner. For this study we investigated the localizations of products of slr1667 and slr1668 (designated cccS and cccP, respectively) biochemically and immunocytochemically, and examined the phenotypes of their disruptants. CccS protein was detected in the culture medium and the acid-soluble fraction containing proteins derived from outside the outer membrane. Disruptants of cccS and cccP showed a more or less similar pleiotropic phenotype. Several proteins secreted into the culture medium or retained on the outside of the outer membrane were greatly reduced in both disruptants compared with the wild type. Electron microscopy revealed that the cccS disruptant lacked the thick pili responsible for motility and that the cccP disruptant had almost no discernible thick pili on its cell surface. Both disruptants largely secreted far greater amounts of yellow pigments into the culture medium than did the wild type. Furthermore, the disruptions reduced the amount of UV-absorbing compound(s) extractable from the exopolysaccharide layer. These results suggest that the cccS and cccP genes are involved in the construction of cell surface components in Synechocystis sp. strain PCC 6803.

Systematic single base-pair substitution analysis of DNA binding by the cAMP receptor protein in cyanobacterium Synechocystis sp. PCC 6803.

The cAMP receptor protein SYCRP1 in cyanobacterium Synechocystis sp. PCC 6803 is a regulatory protein that binds to the consensus DNA sequence (5′‐AAATGTGATCTAGATCACATTT‐3′) for the cAMP receptor protein CRP in Escherichia coli. Here we examined the effects of systematic single base‐pair substitutions at positions 4–8 (TGTGA) of the consensus sequence on the specific binding of SYCRP1. The consensus sequence exhibited the highest affinity, and the effects of base‐pair substitutions at positions 5 and 7 were the most deleterious. The result is similar to that previously reported for CRP, whereas there were differences between SYCRP1 and CRP in the rank order of affinity for each substitution.

ΔG‐based prediction and experimental confirmation of SYCRP1‐binding sites on the Synechocystis genome

DNA‐binding sites for SYCRP1, which is a regulatory protein of the cyanobacterium Synechocystis sp. PCC6803, were predicted for the whole genome sequence by estimating changes in the binding free energy () for SYCRP1 for those sites. The values were calculated by summing ΔΔG values derived from systematic single base‐pair substitution experiments (symmetrical and cooperative binding model). Of the calculated binding sites, 23 sites with a value < 3.9 kcal·mol−1 located upstream or between the ORFs were selected as putative binding sites for SYCRP1. In order to confirm whether SYCRP1 actually binds to these binding sites or not, 11 sites with the lowest values were tested experimentally, and we confirmed that SYCRP1 binds to ten of the 11 sites with a ΔΔGtotal value < 3.9 kcal·mol−1. The best correlation coefficient between and the observed ΔΔGtotal for binding of SYCRP1 to those sites was 0.78. These results suggest that the ΔΔG values derived from systematic single base‐pair experiments may be used to screen for potential binding sites of a regulatory protein in the genome sequence.

Two cAMP receptor proteins with different biochemical properties in the filamentous cyanobacterium Anabaena sp. PCC 7120

Two open reading frames (ORFs), alr0295 and alr2325, are found to encode putative cAMP receptor proteins (CRPs) in the genome of the filamentous cyanobacterium Anabaena sp. PCC 7120. These ORFs were named cAMP receptor protein‐like gene A in Anabaena sp. PCC 7120 (ancrpA) and cAMP receptor protein‐like gene B in Anabaena sp. PCC 7120 (ancrpB), respectively, and those translated products were investigated. The equilibrium dialysis measurements revealed that AnCrpA bound with cAMP specifically, while AnCrpB bound with both cAMP and cGMP, though the affinity for cGMP was weak. The binding affinity for cAMP of AnCrpA showed the lowest dissociation constant, approximately 0.8 μM, among bacterial CRPs. A gel mobility shift assay elucidated that AnCrpA and AnCrpB formed a complex with the consensus DNA sequence in the presence of cAMP, although AnCrpB did not have ordinary DNA‐binding motifs.

Cell Surface-Associated Proteins in the Filamentous Cyanobacterium Anabaena sp. strain PCC 7120

The cell surface senses environmental changes first and transfers signals into the cell. To understand the response to environmental changes, it is necessary to analyze cell surface components, particularly cell surface-associated proteins. We therefore investigated cell surface-associated proteins from the filamentous cyanobacterium Anabaena sp. strain PCC 7120. The cell surface-associated proteins extracted by an acidic buffer were resolved by SDS-PAGE. Eighteen proteins were identified from resolved bands by amino-terminal sequencing. Analysis of cell surface-associated proteins indicated that several proteins among them were involved in nucleic acid binding, protein synthesis, proteolytic activity and electron transfer, and other proteins were involved in the stress response.