James B. Woolley

Finding Our Way through Phenotypes

Imagine if we could compute across phenotype data as easily as genomic data; this article calls for efforts to realize this vision and discusses the potential benefits.

Phylogenetics and classification of Chalcidoidea and Mymarommatoidea — a review of current concepts (Hymenoptera, Apocrita)

Classification and morphological and molecular evidence supporting relationships of Mymarommatidae (Mymarommatoidea) and the 20 families of Chalcidoidea are reviewed. Five autapomorphies support monophyly of Mymarommatoidea, at least two autapomorphies support monophyly of Chalcidoidea, and three synapomorphies support a sister‐group relationship between Mymarommatoidea and Chalcidoidea. Mymaridae are indicated as the likely sister group of all other Chalcidoidea by: two features of the ovipositor, the unique structure of a muscle between the mesofurca and axillary lever, and sequence data from the 28s rDNA gene. Structure of the upper valvulae of the ovipositor could indicate Rotoitidae as the second‐most basal clade of Chalcidoidea. Chalcididae, Elasmidae, Encyrtidae, Eulophidae, Eurytomidae, Leucospidae, Mymaridae, Ormyridae, Rotoitidae, Signiphoridae, Torymidae and Trichogrammatidae are each indicated as monophyletic by at least one putative synapomorphy, but could render other families paraphyletic. Aphelinidae, Eupelmidae, Pteromalidae, and Tetracampidae are not demonstrably monophyletic. Agaonidae is monophyletic only if restricted to Agaoninae, and Eucharitidae is monophyletic only if restricted to Eucharitinae + Oraseminae. Eupelmidae may be paraphyletic with respect to Tanaostigmatidae and Encyrtidae, and Tanaostigmatidae including Cynipencyrtus may be paraphyletic relative to Encyrtidae. Perilampidae (Perilampinae + Chrysolampinae) are either polyphyletic or paraphyletic with respect to Eucharitidae + Akapalinae + Philomidinae. No cladistic hypotheses of familial relationships based on character evidence have considered the superfamily in its entirety.

PHYLOGENY OF THE SUBFAMILIES OF THE FAMILY BRACONIDAE (HYMENOPTERA: ICHNEUMONOIDEA): A REASSESSMENT

Abstract— The recently published phylogeny of Braconidae by Quicke and van Achterberg is reassessed. Character‐state definitions and character polarities are evaluated, and more rigorous methods are suggested. Our results indicate that there are many more parsimonious solutions to their data set, the consensus of which differs substantially from their results. Based on our reassessment, little can be said about the relationships among braconid subfamilies. Consensus trees show the cyclostomes as a largely unresolved basal grade. The two other major lineages which have been proposed, the helconoids and microgastroids, are somewhat better resolved, but not consistently so. Relationships among the helconoids vary considerably depending on the parameters used for parsimony analysis.

Variation and the phylogenetic utility of the large ribosomal subunit of mitochondrial DNA from the insect order Hymenoptera.

Nucleotide sequence variation from a 573-bp region of the mitochondrial 16S rRNA gene was determined for representative hymenopteran taxa. An overall bias in the distribution of A and T bases was observed from all taxa; however, the terebrants (parasitoids) displayed significantly lower AT ratios as well as a higher degree of strand asymmetry. Moreover, a strong positive correlation was observed between relative AT richness and sequence divergence, suggesting selection at the nucleotide level for A and T bases as well as functionality. Overall sequence difference ranged from 2.3 to 53.4%, with the maximum divergence between members of the two Hymenopteran suborders. These data were used in a phylogenetic analysis to illustrate the utility and degree of resolution provided by this information at various hierarchical levels within this taxonomically diverse order. Parsimony analysis revealed strong evidence for monophyly of the aculeates and the terebrants. Most noteworthy was a strongly supported clade containing the two terebrant superfamilies Icheumonoidea and Chalcidoidea. Conversely, high sequence divergence values resulted in instability at the base of the tree and limited resolution at the higher taxonomic levels. Nevertheless, these results do identify those taxonomic levels for which 16S rRNA sequences are phylogenetically informative.

Phylogenetic implications of the mesofurca in Chalcidoidea (Hymenoptera), with emphasis on Aphelinidae

The skeletomusculature of the mesofurcal–mesopostnotal complex is surveyed within the Chalcidoidea. Four internal character systems are assessed for their phylogenetic significance: the mesofurcal bridge, the structure and position of the furcal–laterophragmal muscle, the structure of the lateral arms of the mesofurca, and the supporting structures for the interfurcal muscles. Among Hymenoptera, Chalcidoidea are unique in having the furcal–laterophragmal muscle attached along the entire length of the laterophragmal apodeme. Also the furcal–laterophragmal muscle originates medial to the junction of the mesofurcal bridge and lateral mesofurcal arm in most Chalcidoidea. Mymarommatidae do not share either of these apomorphic states with Chalcidoidea. Within Chalcidoidea, apomorphic character states were found in each of Aphelinidae, Encyrtidae, Eulophidae, Mymaridae, Rotoitidae, Signiphoridae, Tanaostigmatidae and Trichogrammatidae. For taxa classified as Aphelinidae, the plesiomorphic complement of structures and muscle attachments is retained in Eriaphytinae and Eriaporinae. The mesofurcal bridge is considered to have been lost at least twice in each of Aphelininae and Coccophaginae. Similar interfurcal processes, resulting from loss of the mesofurcal bridge, support the monophyly of Aphelininae (Aphelinini, Aphytini and Eutrichosomellini). Azotinae are placed as the sister group of Aphelininae because of a similar lateral origin of the laterophragmal muscle and the shape of the mesofurcal arms. Other than loss of the mesofurcal bridge, no character states were shared by Azotinae and Coccophaginae. Coccophaginae (Coccophagini and Pteroptricini) are regarded as monophyletic based on the loss of the mesofurcal bridge, the peculiar shape of the mesofurca, and a unique modification of the laterophragmal muscle. Euxanthellus is removed from synonomy with Coccophagus and may be best treated as a separate tribe of Coccophaginae based on the shape of the lateral mesofurcal arms and the presence of a mesofurcal bridge. The shape of the mesofurca suggests a monophyletic grouping of Cales, Eretmocerus and Trichogrammatidae that could render Aphelinidae paraphyletic.

Reassessment of the 16S rRNA nucleotide sequence from members of the parasitic hymenoptera

Recently we examined the phylogenetic utility of the large ribosomal subunit of mitochondrial DNA from the insect order Hymenoptera (Derr et al. 1992). That study included nucleotide sequence information for members of six superfamilies from the two hymenopteran suborders (Symphyta and Apocrita). After submitting the manuscript for publication we discovered an error regarding some of the sequences in our original report. By the time the problem was resolved the manuscript was in press and we could not prevent publication. The incorrect sequences were all from the terebrant (“parasitic Hymenoptera”) group and consisted of sequences from three members of the superfamily Ichneumonoidea (Xanthopimpla stemmator, Digonogastra kimballi, and Allorhogas pyralophagus) and sequences from two representatives of the superfamily Chalcidoidea (Aphytis yanonensis and A. lingnanensis). In this report we provide the correct nucleotide sequence for four members of the parasitic group along with a reanalysis of this gene region. In addition, we offer suggestions on how to prevent reporting spurious nucleotide sequence when limited amounts of comparative data are available. We suspect that samples used in our original analyses were contaminated with small amounts of vertebrate DNA through the aqueous phase layered above the phenol used in the phenol-chloroform DNA extraction. We therefore eliminated this step when extracting new genomic DNAs by using a commercially available glass bead DNA purification kit (Schleicher & Schuell). This procedure eliminated the organic extraction/ethanol precipitation step and provided excellent template DNA for PCR amplification. In our original studies template DNAs from all parasitic Hymenoptera failed to amplify due to a nucleotide substitution corresponding to the 3’ end of one “conserved” PCR primer. Therefore, we designed two new pairs of PCR primers that border this region of the 16s rRNA gene. The first primer pair, 16Al and 16B1, are identical to the original primers 16SA and 16SB (Derr et al., 1992) except a single base was deleted at each of the 3’ ends (Fig. 1). Although these primers amplified the appropriate size fragment from the new DNA samples, we could not be sure that this product was not an additional contaminant. In order to ensure that PCR amplifications were limited to insect templates, we constructed an additional primer pair that ended on 3’ positions that consistently differed between insect and vertebrate 16s rRNA sequences. Details of the placement of the A primers are provided in Fig. 1. The sequences of these “taxonomitally limited” primers are as follows: 16A2AGATTTTAAAAGTCGAACAGAClCTlTAA and 16B2 -CGCCTGTTTATCAAAAACATGT. PCR, DNA sequencing, sequence alignment, and the phylogenetic analysis were as reported earlier (Derr et al., 1992). With the use of the primers 16A2 and 16B2, nucleotide sequences were determined from both DNA strands from four members of the superfamily Ichneumonoidea. These included one individual from the family Ichneumonidae (Xunthopimplu stemmator) and three from the family Braconidae (Digonogustra kim-

Phylogeny and classification of the Signiphoridae (Hymenoptera: Chalcidoidea)

Abstract. A data set consisting of twenty‐eight anatomical characters scored for twenty‐eight terminal taxa representing the world fauna of Signiphoridae was analysed using parsimony and compatibility methods. The Coccophaginae (Aphelinidae) and the Azotinae (Aphelinidae) were used as outgroups to establish polarity of character state changes. Relationships of Signiphoridae to other Chalcidoidea are discussed. Several multistate characters were treated in the parsimony analyses either as unordered or as ordered into transformation series using additive binary coding, which in some cases drastically reduced the number of equally parsimonious solutions. Monophyly of Signiphoridae is supported by seven synapomorphies. Four genera, Chartocerus, Thysanus, Clytina and Signiphora, are recognized within Signiphoridae based on synapomorphies. Rozanoviellasyn.n. and Kerrichiellasyn.n. are synonymized under Signiphora. Species of Signiphora are further assigned to four species groups, three of which are demonstrably monophyletic. Nine species or subspecies are transferred to Chartocerus from Signiphora (australicuscomb.n., australiensiscomb.n., australiensis orbiculatus comb.n., beethovenicomb.n., corvinuscomb.n., funeraliscomb.n., reticulatacomb.n., ruskinicomb.n., thusanoidescomb.n.), one species to Thysanus from Signiphora (melancholicuscomb.n.), and one species to Signiphora from Kerrichiella (coleoptratuscomb.n.). A key to genera of Signiphoridae and species groups of Signiphora is presented. A diagnosis, relevant nomenclatural history, and a list of included species are given for each genus and species group, and the biology and distribution of each is summarized.

Comparison of five allopatric fruit fly parasitoid populations (Psyttalia species) (Hymenoptera: Braconidae) from coffee fields using morphometric and molecular methods

Morphometric studies of five allopatric parasitoid populations (genus Psyttalia Walker) from coffee plantations in Cameroon (Nkolbisson), Ghana (Tafo) and Kenya (Rurima, Ruiru and Shimba Hills) and one non-coffee population (from Muhaka, Kenya) were compared with individuals of Psyttalia concolor (Szépligeti), a species released in several biological control programmes in the Mediterranean Region since the 20th Century. Analyses of wing vein measurements showed the second submarginal cell of the fore wing and its adjoining veins had the heaviest principal component weights and served as the main contributing variables in the diagnostic differentiation of the populations. Two populations (Rurima and Ruiru) were found to be the closest to each other and with the strongest phenetic affinity toward P. concolor (and forming one cluster). Populations from Shimba Hills (of unknown identity), Nkolbisson (P. perproximus (Silvestri)) and Tafo formed a second cluster and were separated from P. concolor. Comparison using amplified fragment length polymorphism (AFLP) also showed the Shimba, Nkolbisson and Tafo populations forming a cluster in a dendrogram generated from their genetic distances, with the Shimba and Tafo populations placed as the most closely related species. Based on consistent morphological similarities, morphometric and ecological data coupled with the genetic evidence from AFLP data, the Shimba population is suggested as belonging to the P. perproximus group and, thus, represents a new occurrence record in Kenya. Our results also support earlier conclusion from cross mating data that populations from Rurima and Ruiru belong to the Psyttalia concolor species-group.

Electrophoretic and phylogenetic analyses of selected allopatric populations of the Cotesia flavipes complex (Hymenoptera: Braconidae), parasitoids of cereal stemborers

Abstract Electrophoretic studies were conducted on the Cotesia flavipes Cameron complex and Cotesia glomerata L. (Hymenoptera: Braconidae). Esterase, glucosephosphate isomerase, hexokinase, sorbital dehydrogenase and phosphogluconate dehydrogenase had fixed alleles for the three species and could be used to distinguish them. Cotesia chilonis (Matsumura) and Cotesia sesamiae (Cameron), have a genetic identity value characteristic of distinct species (Nei’s genetic identity, I=0.587). Cladistic analysis of the allozyme data indicated that allopatric populations currently included in C. flavipes may not be a monophyletic group.

Total-evidence phylogenetic analysis and reclassification of the Phylinae (Insecta: Heteroptera: Miridae), with the recognition of new tribes and subtribes and a redefinition of Phylini

The subfamily Phylinae (Heteroptera: Miridae) is one of the largest subfamilies of plant bugs and in the most recent classification comprised six tribes: Pilophorini, Hallodapini, Auricillocorini, Phylini, Pronotocrepini, and Leucophoropterini. Phylogenetic analyses of the subfamily using dynamic homology (POY), parsimony (TNT), and model‐based (RAxML) methods are presented. A dataset comprising both morphological and molecular characters (16S, 18S, 28S, and COI–COII) was assembled for taxon samples of 164 ingroup and nine outgroup taxa. A reclassification of the subfamily based on the POY analysis is presented, recognizing nine tribes and nine subtribes. The Auricillocorini is synonymized with the Hallodapini and the Pronotocrepini with the Cremnorrhini; the Phylini was found to be polyphyletic and is redefined; the Semiini and Nasocorini are resurrected and redefined; and the Decomiini and Coatonocapsiniare presented as new tribes. The Hallodapini, rather than the Pilophorini, was found to be the sister‐group to the remaining Phylinae.