Janette Furuzawa-Carballeda

IL-10— and IL-20—Expressing Epithelial and Inflammatory Cells are Increased in Patients with Ulcerative Colitis

Interleukin (IL)-20, a pro-inflammatory cytokine, is a recently discovered member of the IL-10 family. This cytokine has been described in inflammatory diseases such as psoriasis and asthma. However, IL-20 expression in ulcerative colitis (UC) patients has not been yet described. The aim of this study was to evaluate IL-20 and IL-10 gene and protein expression and their receptors in the mucosa from UC patients. Forty UC patients and 18 non-inflamed controls were studied. IL-10, IL-20, IL-10R1, IL-10R2, IL-20R1 and IL-20R2 gene expression was determined by real time RT-PCR in colonic biopsies. Protein expression was evaluated by immunohistochemistry. Patients in remission had significantly higher IL-10 gene expression in mucosa compared with active patients and controls. Conversely, IL-10R1/B gene expression was decreased in remission compared with active UC patients and controls. IL-20 gene expression was lower in colonic mucosa from UC patients in remission compared with controls and active patients. IL-20R1/B mRNA expression was higher in remission compared with active UC patients and controls. IHQ analysis showed an increased IL-10—, IL-20—, and IL-20R2—producing cells in active UC patients. IL-10—, IL-20— and IL-20R2—expressing epithelial and inflammatory cells were increased in active UC patients, meanwhile IL-20R1 was up-regulated only on inflammatory infiltrates vs. controls. This is the first depiction of the presence of IL-20 and its receptors in UC. Much remains to be learned however, about the pathogenic mechanisms that lead to IBD. This cytokine/receptor imbalance may be implicated in the pathogenesis of UC.

Expression of interleukin (IL)-19 and IL-24 in inflammatory bowel disease patients: a cross-sectional study

Interleukin (IL)‐19 and IL‐24 belong to the IL‐20 subfamily, and are involved in host defence against bacteria and fungi, tissue remodelling and wound healing. Nevertheless, no previous studies have explored their expression in Mexican mestizo patients with inflammatory bowel disease (IBD). The aim of the study was to characterize and to enumerate peripheral and tissue IL‐19‐ and IL‐24‐producing cells, as well as gene expression in patients with IBD with regard to its clinical activity. We studied a total of 77 patients with ulcerative colitis (UC), 36 Crohns disease (CD) and 33 patients as control group (without endoscopic evidence of intestinal inflammation). Gene expression was measured by real‐time–polymerase chain reaction (RT–PCR). Protein expression was detected in biopsies by immunohistochemistry and in freshly isolated peripheral blood mononuclear cells by flow cytometry. IL‐19 and IL‐24 gene expression was elevated significantly in patients with active IBD versus the inactive disease and non‐inflammatory control groups (P < 0·05). However, IL‐19‐ and IL‐24‐producing cells were only increased in active CD versus active UC and non‐inflammatory tissues (P < 0·05). IL‐19 was produced conspicuously by circulating B cells and monocytes in patients with inactive disease (P < 0·05). Conversely, IL‐24 was noticeably synthesized by peripheral B cells, CD4+ T cells, CD8+ T cells and monocytes in patients with active disease. In conclusion, IL‐19‐ and IL‐24‐producing cells in active CD patients were increased compared with active UC and non‐inflammatory tissues. These cytokines could significantly shape and differentiate inflammatory process, severity and tolerance loss between UC and CD pathophysiology.

Interleukin 35 (IL-35) and IL-37: Intestinal and peripheral expression by T and B regulatory cells in patients with Inflammatory Bowel Disease.

The aim of the study was to characterize and to quantify peripheral and tissue. IL-35- and IL-37-producing cells in Inflammatory Bowel Disease (IBD) patients. We studied a total of 38 active UC, 31 inactive UC, 17 active CD, and 13 inactive CD and 50 non-inflamed tissues as control group. Gene expression was measured by real time polymerase chain reaction (RT-PCR) and protein expression was evaluated in tissue by immunohistochemistry and in peripheral blood mononuclear cells by flow cytometry. Higher levels of IL-35 was produced by intestinal regulatory B cells and circulating regulatory CD4(+) and CD8(+) T cells in active vs. inactive disease or healthy donors (P<0.05). The IL-37 was conspicuously synthesized by circulating B cells, active natural killer cells and monocytes. These results suggest that down-regulation of inflammation in active IBD patients might be based on the increased expression of IL-35 and IL-37.

Interleukin 17 gene and protein expression are increased in patients with ulcerative colitis

Interleukin 17 (IL-17) induces the recruitment of immune cells to peripheral tissues, a response that requires nuclear factor jB (NF-jB) activation after IL-17 receptor engagement. IL-17 also leads to the induction of many proinflammatory factors, including tumor necrosis factor alpha (TNF-a), IL-6, IL-23, and IL-1b by innate immune cells and APCs, especially dendritic cells, suggesting an important role for IL-17 in localizing and amplifying the inflammatory process. Furthermore, TNF-a and IL-6 are produced by T helper 17 (Th17) cells, not only support Th17 cell development, but also synergize with IL-17 to enhance the production of proinflammatory mediators. IL-17 as well as Th17 cells have been found to be elevated in serum and intestinal tissue from inflammatory bowel disease (IBD) patients. IL-17 was not detected in inactive IBD tissue or in other colitis. The recent discovery and characterization of Th17 and their signature cytokines (IL-17) represents a hallmark in T-cell immunobiology by providing a new, distinctive pathway for communication between adaptive and innate immunity. This is the first study to our best knowledge with a larger sample that explores IL-17 gene and protein expression from colonic biopsies in patients with ulcerative colitis (UC) and includes a healthy control group. In this study we evaluated the gene and protein expression of IL-17 in the colonic mucosa from 36 patients with UC (21 active and 15 in remission) and 18 healthy controls without endoscopic or histological evidence of mucosal inflammation. Gene expression of IL-17 was measured by real-time polymerase chain reaction (RT-PCR) after total RNA extraction and complementary DNA was synthesized by PCR. The following primers were used: IL-17-forward: tggggtcccaagtgacag and reverse: ggcatcatcaatgaaaacca, GADPH-forward: gcccaatacgaccaaatcc and reverse: agcca catcgctcagaca for normalization in the respective cDNA preparation. In order to determine IL-17 protein expression from intestinal biopsies from UC patients, tissues were immunostained and compared with noninflamed tissue. The detection of IL-17 protein in tissue was performed by immunohistochemistry. Peroxidase staining of paraffin-embedded tissue slides was performed using standard protocols. Briefly, after deparaffinization and demasking of antigens, endogenous peroxidases were blocked with H2O2. Slides were blocked with 10% normal serum and were incubated with avidin and biotin. Following incubation with the primary antibody overnight at 4 C, slides were incubated with the FIGURE 1. Gene expression of IL-17 in colonic mucosa from patients with UC (active/remission) and healthy controls and the constitutive gene GADPH. *P < 0.001.

Peroxisome Proliferator-Activated Receptors Family Is Involved in the Response to Treatment and Mild Clinical Course in Patients with Ulcerative Colitis

Background. PPARs play an important role in the regulation of intestinal inflammation. Methods. We included a total of 46 UC patients and 31 controls. The gene expression of PPARs was measured by RT-PCR and protein expression by immunohistochemistry. Results. PPARα gene expression was significantly decreased in patients with active UC compared with remission UC group (P = 0.001) and controls (P = 0.001). We found that low gene expression of PPARα in mucosa confers a higher risk of UC activity (P ≤ 0.0001, OR = 22.6). We observed an increase of PPARα expression in patients with UC who were treated with 5-aminosalicylates compared with those who received any other combined therapy (P = 0.03, OR = 0.08). PPARγ gene expression was decreased in the active UC group compared with UC in remission (P = 0.001) and control group (P = 0.001). An increased expression of PPARγ gene was associated with mild clinical course of the disease (P ≤ 0.001, OR = 0.05). No gene expression of PPARβ/δ was found in the colonic mucosa from UC patients and controls. Conclusion. Our results suggest that patients with high gene expression of PPARs have a better response to medical treatment and a mild clinical course of the disease.

Indoleamine 2,3-Dioxygenase: Expressing Cells in Inflammatory Bowel Disease—A Cross-Sectional Study

Aim. To characterise and enumerate IDO+ cells, Tregs, and T cell subsets in patients with ulcerative colitis (UC) and Crohns disease (CD) with regard to their clinical activity. Methods. Ten active UC (aUC), 10 inactive UC (iUC), 6 aCD, and 8 iCD patients and 10 healthy individuals were included in the study. Circulating Foxp3-, IDO-, IL-17A-, IL-4-, IFN-γ-, and IL-10-expressing CD4+ T cells were quantitated by flow cytometry. Interleukin-17-expressing cells, CD25+/Foxp3+ Tregs, and CD123+/IDO+ plasmacytoid dendritic cells were evaluated in intestinal biopsies from 10 aUC, 6 aCD, and 10 noninflamed tissues. Results. All CD4+ T subsets were increased in aIBD patients compared with healthy donors. Meanwhile, frequency of CD8α +/CD16+/IDO+, CD8α +/CD56+/IDO+, CD8α +/CD80+/IDO+, CD8α +/CD123+/IDO+ large granular nonlymphoid cells, and CCR6+/CD123+/IDO+ plasmacytoid dendritic cells was higher in aIBD patients versus healthy donors or iIBD patients. Tissue IL-17A+ cells were present in higher amounts in aIBD versus noninflamed controls. IDO- and Foxp3-expressing cells were increased in aUC versus aCD patients and noninflamed tissues. Conclusions. The findings represent an original work in Mexican Mestizo patients with IBD. It shows that Tregs and IDO-expressing cells are increased with regard to disease activity. These cells could significantly shape inflammatory bowel disease pathophysiology, severity, and tolerance loss.

Role of the interleukin 24 in patients with ulcerative colitis

To the Editor: Interleukin 24 (IL-24) is a member of the IL-10 family of cytokines (together with IL-19, IL-20, IL-22, IL26, IL-28, and IL-29). IL-24 was originally identified as a tumor suppressor molecule (melanoma differentiationassociated gene 7). IL-24 shares amino acid homology between 20 and 30% with IL-10, IL-20, and IL-22. The human IL-24 has been reported to induce the expression of proinflammatory cytokines such as tumor necrosis factor alpha (TNF-a) and IL-6 in monocytes. In vivo, IL-24 is predominantly expressed by skin tissue cells during inflammatory conditions such as psoriasis. IL-24 acts on colonic epithelial cells to elicit JAK1/ STAT-3 activation and the expression of mucins, supporting its suppressive effects on mucosal inflammation in inflammatory bowel disease (IBD). No previous studies have explored the role of IL-24 in patients with ulcerative colitis (UC). This is the first study to our best knowledge that explores the expression of IL-24 in colonic mucosa from patients with UC. In this study we investigated the expression of IL-24 in the colonic mucosa of 40 patients with UC (25 active and 15 remission) and 18 healthy controls without endoscopic and histological evidence of mucosal inflammation. Expression of IL-24 was measured by real-time polymerase chain reaction (RT-PCR) after total RNA extraction and complementary DNA was synthesized by PCR. The following primers were used: IL-24 forward: cagggtgtggacaaggtaaca and reverse: ctcaggataacatcacgagtgc; GADPH forward: gcccaatacgaccaaatcc and reverse: agccacatcgctcagaca for normalization. The detection of IL-24 protein in tissue was performed by immunohistochemistry. Peroxidase staining of paraffin-embedded tissue slides was performed using standard protocols. Briefly, after deparaffinization and demasking of antigens, endogenous peroxidases were blocked with H2O2. Slides were blocked with 10% normal serum and were incubated with avidin and biotin. Following incubation with the primary antibody overnight at 4 C, slides were incubated with the secondary, biotin-conjugated antibody. Next, they were incubated with horseradish peroxidase (HRP)-streptavidin, followed by incubation with the peroxidase substrate 30-diaminobenzidine (DAB). IL-24 mRNA expression was higher in the colonic mucosa from patients with active UC and UC remission when compared with normal controls (P < 0.0001 and P 1⁄4 0.001, respectively) as shown in Figure 1. The gene expression of IL-24 was also significantly increased in the group of active UC as compared to the UC remission group (P 1⁄4 0.001).

Differential Expression of MUC12, MUC16, and MUC20 in Patients with Active and Remission Ulcerative Colitis

Background. Patients with UC have shown an important defect in the secretion and maintenance of the mucosal barrier as part of inadequate expression of mucin genes. The aim of the present study was to determine the expression of MUC12, MUC16, and MUC20 in colonic tissue from patients with UC in regard to their clinical outcomes. Methods. We included a total of 40 patients with UC and 30 normal controls. Mucin gene expression was performed by RT-PCR and protein expression was detected by immunohistochemistry. Results. Patients with active UC showed no significant expression of MUC12 gene in mucosa compared to the group of patients with UC in remission and the normal control group. MUC16 gene expression was significantly increased in the UC active and remission groups compared to the normal control group (P = 0.03). MUC20 gene expression was found significantly decreased in patients with active UC compared to both remission group (P = 0.001) and normal controls (P = 0.001). Furthermore, an association was found between MUC20 gene expression and the presence of histological remission in patients with UC (P = 0.003, OR = 0.37). Conclusions. An increased gene expression of MUC16 and MUC20 was found in patients with remission UC.

The Transient Receptor Potential Vanilloid 1 Is Associated with Active Inflammation in Ulcerative Colitis

The transient receptor potential vanilloid 1 (TRPV1) may play a role in the pathogenesis of ulcerative colitis (UC). The aim of the study was to determine the gene and protein expression of TRPV1 in UC patients and noninflamed controls. Gene expression was performed by RT-PCR, and protein expression was performed by immunohistochemistry. The gene expression of TRPV1 was significantly increased in the remission UC group compared to active UC patients (P = 0.002), and an upregulation of the TRPV1 gene was associated with clinical outcomes such as age at diagnosis (<40 years) (P = 0.02) and clinical disease course characterized by relapsing and continuous activity (P = 0.07). TRPV1 immunoreactive cells were conspicuously higher in all intestinal layers from active UC patients compared with noninflamed control tissue. These findings suggest that TRPV1 might be involved in UC pathogenesis.

P185 Mucin 16 (MUC16) and mucin 20 (MUC20) over-expression in colonic mucosa is associated with histological remission in patients with ulcerative colitis

P184 Mucosal healing does not correspond to histological healing in ulcerative colitis L. Laterza1 *, I. Scoleri1, S. Bibbo1, E. Gaetani1, G. Bruno1, L. Larosa2, A. Poscia3, A. Amato4, L.M. Minordi2, L. Bonomo2, G. Cammarota1, A. Gasbarrini1, V. Gerardi1. 1Gastroenterology Division, Catholic University of the Sacred Hearth, Rome, Italy, 2Radiology Department, Catholic University of the Sacred Hearth, Rome, Italy, 3Institute of Hygiene, Catholic University of the Sacred Hearth, Rome, Italy, 4Institute of Anestesiology, Catholic University of the Sacred Hearth, Rome, Italy