Gabriela Fonseca-Camarillo

Transcript levels of Toll-Like receptors 5, 8 and 9 correlate with inflammatory activity in Ulcerative Colitis

BackgroundDysregulation of innate immune response by Toll-Like Receptors (TLRs) is a key feature in Ulcerative Colitis (UC). Most studies have focused on TLR2, TLR3, and TLR4 participation in UC. However, few studies have explored other TLRs. Therefore, the aim of this study was to evaluate the mRNA profiles of TLR1 to 9 in colonic mucosa of UC patients, according to disease activity.MethodsColonic biopsies were taken from colon during colonoscopy in 51 patients with Ulcerative Colitis and 36 healthy controls. mRNA levels of TLR1 to 9, Tollip, inflammatory cytokines IL6 and TNF were assessed by RT-qPCR with hydrolysis probes. Characterization of TLR9 protein expression was performed by Immunohistochemistry.ResultsToll-like receptors TLR8, TLR9, and IL6 mRNA levels were significantly higher in the colonic mucosa from UC patients (both quiescent and active) as compared to healthy individuals (p < 0.04). In the UC patients group the TLR2, TLR4, TLR8 and TLR9 mRNA levels were found to be significantly lower in patients with quiescent disease, as compared to those with active disease (p < 0.05), whereas TLR5 showed a trend (p = 0.06). IL6 and TNF mRNA levels were significantly higher in the presence of active disease and help to discriminate between quiescent and active disease (p < 0.05). Also, IL6 and TNF mRNA positively correlate with TLRs mRNA with the exception for TLR3, with stronger correlations for TLR5, TLR8, and TLR9 (p < 0.0001). TLR9 protein expression was mainly in the lamina propria infiltrate.ConclusionsThis study demonstrates that TLR2, TLR4, TLR8, and TLR9 expression increases in active UC patients, and that the mRNA levels positively correlate with the severity of intestinal inflammation as well as with inflammatory cytokines.

IL-10— and IL-20—Expressing Epithelial and Inflammatory Cells are Increased in Patients with Ulcerative Colitis

Interleukin (IL)-20, a pro-inflammatory cytokine, is a recently discovered member of the IL-10 family. This cytokine has been described in inflammatory diseases such as psoriasis and asthma. However, IL-20 expression in ulcerative colitis (UC) patients has not been yet described. The aim of this study was to evaluate IL-20 and IL-10 gene and protein expression and their receptors in the mucosa from UC patients. Forty UC patients and 18 non-inflamed controls were studied. IL-10, IL-20, IL-10R1, IL-10R2, IL-20R1 and IL-20R2 gene expression was determined by real time RT-PCR in colonic biopsies. Protein expression was evaluated by immunohistochemistry. Patients in remission had significantly higher IL-10 gene expression in mucosa compared with active patients and controls. Conversely, IL-10R1/B gene expression was decreased in remission compared with active UC patients and controls. IL-20 gene expression was lower in colonic mucosa from UC patients in remission compared with controls and active patients. IL-20R1/B mRNA expression was higher in remission compared with active UC patients and controls. IHQ analysis showed an increased IL-10—, IL-20—, and IL-20R2—producing cells in active UC patients. IL-10—, IL-20— and IL-20R2—expressing epithelial and inflammatory cells were increased in active UC patients, meanwhile IL-20R1 was up-regulated only on inflammatory infiltrates vs. controls. This is the first depiction of the presence of IL-20 and its receptors in UC. Much remains to be learned however, about the pathogenic mechanisms that lead to IBD. This cytokine/receptor imbalance may be implicated in the pathogenesis of UC.

Immunoregulatory Pathways Involved in Inflammatory Bowel Disease.

Abstract:Inflammatory bowel diseases (IBD) include ulcerative colitis and Crohns disease. The immune response in ulcerative colitis is different from the Crohns disease. Accumulating evidence suggests that IBD results from an inappropriate inflammatory response to intestinal microbes in a genetically susceptible host. Several immunoregulatory abnormalities have been reported in patients with IBD, including the ratio of proinflammatory (tumor necrosis factor alpha, IL-6, IL-1-&bgr;) to immunoregulatory cytokines (IL-10, TGF-&bgr;, IL-35) and selective activation of T-helper (Th) lymphocyte subsets (Th1, Th2, Th9, Th17, and regulatory T cells). The purpose of this review is to show the immunoregulatory pathways (regulatory cells and cytokines) involved in IBD published in recent years.

Expression of interleukin (IL)-19 and IL-24 in inflammatory bowel disease patients: a cross-sectional study

Interleukin (IL)‐19 and IL‐24 belong to the IL‐20 subfamily, and are involved in host defence against bacteria and fungi, tissue remodelling and wound healing. Nevertheless, no previous studies have explored their expression in Mexican mestizo patients with inflammatory bowel disease (IBD). The aim of the study was to characterize and to enumerate peripheral and tissue IL‐19‐ and IL‐24‐producing cells, as well as gene expression in patients with IBD with regard to its clinical activity. We studied a total of 77 patients with ulcerative colitis (UC), 36 Crohns disease (CD) and 33 patients as control group (without endoscopic evidence of intestinal inflammation). Gene expression was measured by real‐time–polymerase chain reaction (RT–PCR). Protein expression was detected in biopsies by immunohistochemistry and in freshly isolated peripheral blood mononuclear cells by flow cytometry. IL‐19 and IL‐24 gene expression was elevated significantly in patients with active IBD versus the inactive disease and non‐inflammatory control groups (P < 0·05). However, IL‐19‐ and IL‐24‐producing cells were only increased in active CD versus active UC and non‐inflammatory tissues (P < 0·05). IL‐19 was produced conspicuously by circulating B cells and monocytes in patients with inactive disease (P < 0·05). Conversely, IL‐24 was noticeably synthesized by peripheral B cells, CD4+ T cells, CD8+ T cells and monocytes in patients with active disease. In conclusion, IL‐19‐ and IL‐24‐producing cells in active CD patients were increased compared with active UC and non‐inflammatory tissues. These cytokines could significantly shape and differentiate inflammatory process, severity and tolerance loss between UC and CD pathophysiology.

Interleukin 35 (IL-35) and IL-37: Intestinal and peripheral expression by T and B regulatory cells in patients with Inflammatory Bowel Disease.

The aim of the study was to characterize and to quantify peripheral and tissue. IL-35- and IL-37-producing cells in Inflammatory Bowel Disease (IBD) patients. We studied a total of 38 active UC, 31 inactive UC, 17 active CD, and 13 inactive CD and 50 non-inflamed tissues as control group. Gene expression was measured by real time polymerase chain reaction (RT-PCR) and protein expression was evaluated in tissue by immunohistochemistry and in peripheral blood mononuclear cells by flow cytometry. Higher levels of IL-35 was produced by intestinal regulatory B cells and circulating regulatory CD4(+) and CD8(+) T cells in active vs. inactive disease or healthy donors (P<0.05). The IL-37 was conspicuously synthesized by circulating B cells, active natural killer cells and monocytes. These results suggest that down-regulation of inflammation in active IBD patients might be based on the increased expression of IL-35 and IL-37.

Colonic epithelial upregulation of interleukin 22 (IL-22) in patients with ulcerative colitis.

To the Editor: Inflammatory bowel disease (IBD) is a chronic inflammatory disease thought to be mediated by dysfunctional innate and/or adaptive immunity. This aberrant immune response leads to the secretion of harmful cytokines that destroy the epithelium of the gastrointestinal tract and thus cause further inflammation. Interleukin (IL)-22, a member of the IL-10 subfamily, is a recently identified T-cell-derived cytokine. Expression of IL-22 is induced in several human inflammatory conditions, including IBD. A recent article published by Sugimoto et al found that IL-22 gene delivery led to rapid amelioration of local intestinal inflammation in a dextran sulfate sodium-induced model of acute colitis. Expression of the IL-22 receptor is restricted to innate immune cells; however, the role of IL22 in ulcerative colitis (UC) patients has not yet been defined. This is the first study to our best knowledge with a larger sample that explores IL-22 gene expression from rectal biopsies in patients with UC. We measured the IL22 gene expression from rectum biopsies of UC patients from September 2008 to September 2009. All individuals were divided in 3 groups: 1) active UC (n 1⁄4 26); 2) long-term UC remission (n 1⁄4 11); and 3) a healthy control group (n 1⁄4 18). Expression of mRNA IL-22 was measured with a real-time polymerase chain reaction (RT-PCR) method. The following primers were used: IL-22 forward: ccctcaatctgataggttccag and reverse: gcaggtcatcaccttcaatatg; GADPH forward: gcccaatac gaccaaatcc and reverse: agccacatcgctcagaca for normalization. These results showed that IL-22 mRNA expression was upregulated in rectal mucosa from patients with active UC compared to UC patients in remission and healthy controls (P < 0.04 and P < 0.0001, respectively). Interestingly, the expression of IL-22 was also significantly increased in remission UC as compared to normal controls (P < 0.01) as shown in Figure 1. We also found that IL-22 gene expression correlated with histological activity (r 1⁄4 0.63 P < 0.0007) by Spearman correlation test. These findings confirmed the potential role of the IL-22 gene in the pathogenesis of UC and suggests that IL-22 might be involved as a defense mechanism by enhanced mucus production. In conclusion, gene expression of IL-22 was found to be increased from rectal biopsies in patients with UC.

Interleukin 17 gene and protein expression are increased in patients with ulcerative colitis

Interleukin 17 (IL-17) induces the recruitment of immune cells to peripheral tissues, a response that requires nuclear factor jB (NF-jB) activation after IL-17 receptor engagement. IL-17 also leads to the induction of many proinflammatory factors, including tumor necrosis factor alpha (TNF-a), IL-6, IL-23, and IL-1b by innate immune cells and APCs, especially dendritic cells, suggesting an important role for IL-17 in localizing and amplifying the inflammatory process. Furthermore, TNF-a and IL-6 are produced by T helper 17 (Th17) cells, not only support Th17 cell development, but also synergize with IL-17 to enhance the production of proinflammatory mediators. IL-17 as well as Th17 cells have been found to be elevated in serum and intestinal tissue from inflammatory bowel disease (IBD) patients. IL-17 was not detected in inactive IBD tissue or in other colitis. The recent discovery and characterization of Th17 and their signature cytokines (IL-17) represents a hallmark in T-cell immunobiology by providing a new, distinctive pathway for communication between adaptive and innate immunity. This is the first study to our best knowledge with a larger sample that explores IL-17 gene and protein expression from colonic biopsies in patients with ulcerative colitis (UC) and includes a healthy control group. In this study we evaluated the gene and protein expression of IL-17 in the colonic mucosa from 36 patients with UC (21 active and 15 in remission) and 18 healthy controls without endoscopic or histological evidence of mucosal inflammation. Gene expression of IL-17 was measured by real-time polymerase chain reaction (RT-PCR) after total RNA extraction and complementary DNA was synthesized by PCR. The following primers were used: IL-17-forward: tggggtcccaagtgacag and reverse: ggcatcatcaatgaaaacca, GADPH-forward: gcccaatacgaccaaatcc and reverse: agcca catcgctcagaca for normalization in the respective cDNA preparation. In order to determine IL-17 protein expression from intestinal biopsies from UC patients, tissues were immunostained and compared with noninflamed tissue. The detection of IL-17 protein in tissue was performed by immunohistochemistry. Peroxidase staining of paraffin-embedded tissue slides was performed using standard protocols. Briefly, after deparaffinization and demasking of antigens, endogenous peroxidases were blocked with H2O2. Slides were blocked with 10% normal serum and were incubated with avidin and biotin. Following incubation with the primary antibody overnight at 4 C, slides were incubated with the FIGURE 1. Gene expression of IL-17 in colonic mucosa from patients with UC (active/remission) and healthy controls and the constitutive gene GADPH. *P < 0.001.

TLR9 mRNA expression is upregulated in patients with active ulcerative colitis

To the Editor: TLR9 is a member of the innate immunity Toll-like receptors (TLRs) family that recognizes bacterial unmethylated CpG DNA motifs. In experimental models of colitis, activation of TLR9 with artificial CpG ODN has proven beneficial. Also, TLR9 was reported to mediate interleukin 8 (IL8) production in colonic epithelial cell lines in response to DNA from pathogenic bacteria. Genetic studies have shown that polymorphisms in TLRs may participate in both Crohn’s disease (CD) and ulcerative colitis (UC). In particular, TLR9 ( 1237T/C) polymorphism has recently been implicated in the development of IBD. Recently, Ghadimi at al showed that TLR9 activation by commensal-origin bacteria DNA is important in the induction of IL-8 production. To our best knowledge, this is the first study designed to evaluate TLR9 gene expression from rectal biopsies in patients with UC. We quantified mRNA levels in rectal biopsy specimens from UC patients and healthy controls. Forty-nine rectal biopsies were obtained from a first cohort group that consisted of 38 UC patients (22 active and 16 remission) as well as 11 healthy controls. All individuals were assessed for TLR9 and IL-6 mRNA transcript levels relative to RPLP0 constitutive gene using real-time reverse-transcription polymerase chain reaction (RT-PCR) using LNA TaqMan probes from Roche (Nutley, NJ) in combination with target gene-specific primers (primer sequences: TLR9 50-TGTGAAGCATG GTTCCCTGT-30, 50-GAGAGACAGCG GGTGCAG-30, IL6 50-GCCCAGCTAT GAACTCCTTCT-30, 50-GAAGGCAGC AGGCAACAC-30 RPLP0 50-ACAGGG CGACCTGGAAGT-30, 50-GGATCTGC TGCATCTGCTT-30). In order to confirm these findings, we also studied a second cohort group that consisted of 36 UC patients (27 active, 9 remission) and 22 healthy controls. Both cohorts were also assessed for TLR9 and IL-6 mRNA relative to RPLP0 as previously described. All results were calibrated to the same control sample performed in all experiments in both cohorts. Also, to solve a possible bias from housekeeping selection both b-actin (50-CCAACCGC GAGAAGATGA-30, 50-CCAGAGGCG TACAGGGATAG-30) and GAPDH (50AGCCACATCGCTCAGACAC-30, 50-G CCCAATACGACCAAATCC-30) were also assessed in the second cohort group. Analysis of the whole sample showed that TLR9 mRNA levels were found significantly increased in the UC active group when compared with healthy controls and patients with UC in remission and healthy controls (Fig. 1A). A good correlation was found between TLR9 with IL6 (r 1⁄4 0.603 P < 0.001) (Fig. 1B). Results from the

Interleukin 21 Expression Is Increased in Rectal Biopsies from Patients with Ulcerative Colitis

To the Editor: Interleukin 21 (IL-21) is a T-cell derived cytokine member of the common gamma-chain-dependent cytokine family, which in general acts on intestinal epithelium helping to maintain the ongoing Th1 inflammation inducing the production of IFN-c. IL-21 also has shown to enhance the expansion of NK cells. IL-21 is expressed by immune T and B cells and nonimmune-like fibroblasts where it activates the metalloproteinase 1 production, signaling through its receptor IL-21R activates STAT-3 in T cells. IL-21, like IL-6 and IL-23, is also involved in Th17 cell differentiation and it is overexpressed in Crohn’s disease (CD). Genetic variants in the region harboring IL2/IL21 have been associated with the genetic susceptibility for developing ulcerative colitis (UC). A recent study has reported IL-21 receptor (IL-21R)-positive cells were significantly increased in inflamed mucosa of inflammatory bowel disease (IBD) patients compared with controls, and mainly expressed in freshly isolated peripheral blood (PB) and lamina propria (LP)-CD4(þ), CD8(þ) T, B, and NK cells. However, this is the first study to our best knowledge with a larger sample that explores the IL-21 gene expression from rectal biopsies in patients with UC. We measured the IL-21 gene expression from rectum biopsies of UC patients from September 2008 to July 2009. All individuals were divided into 3 groups: 1) active UC (n 1⁄4 21); 2) long-term UC remission (n 1⁄4 21); and 3) normal control group (n 1⁄4 20). Expression of mRNA IL-21 and IL-6 were measured by real time polymerase chain reaction (RT-PCR). The following primers were used: IL-21 forward: aggaaaccaccttccacaaa and reverse: gaatcacatgaagggcatgtt; GADPH forward: gcccaatac gaccaaatcc and reverse: agccacatcgctcagaca for normalization. These results showed that IL-21 mRNA expression was increased in rectal mucosa from patients with active UC compared to UC patients in remission and the healthy control group (P 1⁄4 0.025 and P 1⁄4 0.007, respectively). The IL-21 expression was similar in patients with UC in remission and the healthy control group (P 1⁄4 0.546), as shown in Figure 1. We also found that IL-21 gene expression correlated with histological activity (r 1⁄4 0.675, P 1⁄4 0.001) by Spearman correlation test. These findings confirmed the potential role of IL21 gene in the pathogenesis of UC and suggest that antibodies directed to IL21 could be used as a potential target for treating patients with IBD. In conclusion, high gene expression of IL-21 was found from rectal biopsies in patients with UC.

Peroxisome Proliferator-Activated Receptors Family Is Involved in the Response to Treatment and Mild Clinical Course in Patients with Ulcerative Colitis

Background. PPARs play an important role in the regulation of intestinal inflammation. Methods. We included a total of 46 UC patients and 31 controls. The gene expression of PPARs was measured by RT-PCR and protein expression by immunohistochemistry. Results. PPARα gene expression was significantly decreased in patients with active UC compared with remission UC group (P = 0.001) and controls (P = 0.001). We found that low gene expression of PPARα in mucosa confers a higher risk of UC activity (P ≤ 0.0001, OR = 22.6). We observed an increase of PPARα expression in patients with UC who were treated with 5-aminosalicylates compared with those who received any other combined therapy (P = 0.03, OR = 0.08). PPARγ gene expression was decreased in the active UC group compared with UC in remission (P = 0.001) and control group (P = 0.001). An increased expression of PPARγ gene was associated with mild clinical course of the disease (P ≤ 0.001, OR = 0.05). No gene expression of PPARβ/δ was found in the colonic mucosa from UC patients and controls. Conclusion. Our results suggest that patients with high gene expression of PPARs have a better response to medical treatment and a mild clinical course of the disease.