Jaroslav Polák

P230 BCR/ABL protein may be associated with an acute leukaemia phenotype

The BCR/ABL rearrangement, the molecular hallmark of chronic myelogenous leukaemia (CML), is rare in acute myeloid leukaemia (AML), being detected in approximately 1% of cases. In the vast majority of CML cases the breakpoint on chromosome 22 falls in the so‐called major breakpoint cluster region of the BCR gene. Only a few cases of CML with breakpoint in the minor or in the micro bcr region have so far been reported. The micro breakpoint position has been associated mainly with a mild form of CML, defined as Philadelphia chromosome‐positive chronic neutrophilic leukaemia (Ph‐positive CNL). Using reverse transcription‐polymerase chain reaction (RT‐PCR) we report a patient with an acute myeloid leukaemia phenotype at diagnosis who showed a BCR/ABL rearrangement with a breakpoint located in the micro bcr region (e19a2 junction). Cytogenetic analysis showed a progression of the malignant clone, finally leading to cells with two Ph chromosomes, trisomy 8, isochromosome 17q and deletion of the long arms of chromosome 7. The findings of chromosomal changes point to a possibility of blast crisis of CML with a clinically silent chronic phase. Immunoprecipitation and auto‐phosphorylation assay revealed the expression, by the patients blast cells, of an abnormal P230 BCR/ABL protein, which showed for the first time that this protein was constitutively activated in primary cells from patients. This finding may contribute to the understanding of the role of the BCR/ABL rearrangements in determining different leukaemia phenotypes ranging from acute lymphoid and myeloid leukaemias to mild chronic neutrophilic leukaemias.

High level of full-length cereblon mRNA in lower risk myelodysplastic syndrome with isolated 5q deletion is implicated in the efficacy of lenalidomide

Downregulation of cereblon (CRBN) gene expression is associated with resistance to the immunomodulatory drug lenalidomide and poor survival outcomes in multiple myeloma (MM) patients. However, the importance of CRBN gene expression in patients with myelodysplastic syndrome (MDS) and its impact on lenalidomide therapy are not clear. In this study, we evaluate cereblon expression in mononuclear cells isolated from bone marrow [23 lower risk MDS patients with isolated 5q deletion (5q‐), 37 lower risk MDS patients with chromosome 5 without the deletion of long arms (non‐5q‐), and 24 healthy controls] and from peripheral blood (38 patients with 5q‐, 52 non‐5q‐ patients and 25 healthy controls) to gain insight into, firstly, the role of cereblon in lower risk MDS patients with or without 5q deletion and, secondly, into the mechanisms of lenalidomide action. Patients with 5q‐ lower risk MDS have the highest levels of CRBN mRNA in comparison with both lower risk MDS without the deletion of long arms of chromosome 5 and healthy controls. CRBN gene expression was measured using the quantitative TaqMan real‐time PCR. High levels of CRBN mRNA were detected in all lenalidomide responders during the course of therapy. A significant decrease of the CRBN mRNA level during lenalidomide treatment is associated with loss of response to treatment and disease progression. These results suggest that, similar to the treatment of MM, high levels of full‐length CRBN mRNA in lower risk 5q‐ patients are necessary for the efficacy of lenalidomide.

Minimal residual disease detectable by quantitative assessment of WT1 gene before allogeneic stem cell transplantation in patients in first remission of acute myeloid leukemia has an impact on their future prognosis.

Overall 42 patients (pts) transplanted in hematological CR1 were retrospectively analyzed. Median follow‐up was 15 months (range 2–77). The expression of WT1 gene was measured according to the European Leukaemia Net recommendations. At the time of allogeneic stem cell transplantation (allo‐SCT) 29 pts were WT1‐negative and 13 pts were WT1‐positive. In the univariate analysis, significantly better results were observed in the group of WT1 neg in terms of progression‐free survival (in three yr 77% vs. 27%, p = 0.001). In multivariate analysis, the only significant feature in terms of better OS was WT1 negativity (p = 0.029). Our results show that minimal residual disease status measured by quantitative assessment of WT1 gene in acute myeloid leukemia pts in CR1 significantly affects their future prognosis after allo‐SCT.

Type J CBFβ/MYH11 Transcript in the M4Eo Subtype of Acute Myeloid Leukemia

Abstract Acute myeloid leukemia (AML) carrying inversion or translocation of chromosome 16 is usually associated with the FAB M4Eo morphological subtype and belongs to AMLs with a relatively favorable prognosis. At the molecular level, it is associated with a disease-specific fusion gene, CBFβ/MYH11. Previously, 10 different types of CBFβ/MYH11 fusion transcripts have been described in the literature, 7 of them are still known as unique cases. In the current study, peripheral blood and/or bone marrow samples from 265 AML patients were tested for the presence of the CBFβ/MYH11 fusion using RT-PCR and 12 (4.5%) positive cases were identified. The most common type A CBFβ/MYH11 transcript was confirmed in 11 patients. The transcript in the remaining one (a 71-year-old female) was different and sequence analysis allowed us to classify it as CBFβ/MYH11 type J. In contrast to the first type J case previously reported from Australia, this patient exhibited a typical FAB M4Eo morphology. The evidence of the second case indicates that the type J breakage might be a non-random event within the MYH11 gene.

N-terminally truncated WT1 variant (sWT1) is expressed at very low levels in acute myeloid leukemia and advanced phases of chronic myeloid leukemia.

The Wilms’ tumour gene 1 (WT1) encodes a multifunctional proein important for regulation of cell growth and survival. It plays role in many physiological developmental processes and also n cancers including leukemia. WT1 is overexpressed in most of eukemias and therefore it is sometimes even called a “panleukemic arker”. Total WT1 expression level is used in monitoring minimal esidual disease in acute myeloid leukemia (AML) and myelodyslastic syndrome (MDS) patients [1]. Besides this, WT1 is being urrently tested for vaccination. Although the oncogenic behaviour f WT1 in leukemia has been proved, the mechanism has not yet een clearly explained. Detailed understanding of the role of WT1 n leukemia will improve the utilization of WT1 in diagnostics, rognostics and also in therapy. WT1 has an enormous number of ariants due to alternative splicing, alternative initiation of transation etc. In 2004, a novel N-terminally truncated WT1 variant sWT1) has been described by Dalloso et al. [2]. The sWT1 arises rom alternative first exon E1a; it lacks the N-terminal transcripional repression domain of full length WT1 (fWT1) and it activates xpression of genes, which are repressed by fWT1. Hossain et al. 3] reported overexpression of sWT1 in leukemias and assumed hat sWT1 might be the oncogenic WT1 variant based on in vitro xperiments. Recently, we have read with high interest a study of shikawa et al. [4] which supplemented Hossain’s and also our own ata on sWT1 expression in myeloid leukemias. In our study, we have tested sWT1 expression in chronic myeloid eukemia (CML) and AML patients. We designed discriminating forard primers hybridizing onto exon E1 or E1a and common probe nd reverse primer hybridizing onto exon 2 to distinguish between WT1 and sWT1: forward sWT1 5′-cctgcctactcctgggct-3′, forward WT1 5′-cagcccgctattcgcaatc-3′, reverse 5′-tcatgcttgaatgagtggttgg′ and probe 5′-FAM cagcacggtcaccttcgacggga BHQ1-3′. We used DNAs from K562, CML-T1 and JURL-MK1 cell lines as positive ontrols. All three cell lines expressed low levels of sWT1 (less han normalized 100 copies) and high levels of fWT1 (more than 0,000 normalized copies). The cDNAs from total leukocytes of four ormal individuals were used as negative controls; WT1 expresion was negligible. Plasmid standards prepared from K562 cell ine were used for checking reaction sensitivity, preparing stanard curves and performing quantification. Expression data were ormalized to glucoronidase (GUS) gene expression [5]. We have nalyzed samples of total leukocytes of peripheral blood (PB) in 48 ML and 18 CML patients. AML samples were collected at the time f diagnosis; different FAB subtypes were included in the study. ix of 18 CML patients’ samples were collected in major moleclar response (MMR, BCR-ABL levels ≤ 0.1%), 6 in hematological elapse (Hr, increase in leukocyte count over the physiological level f 10 × 109/L of peripheral blood) and 6 in accelerated phase (AP;

Molecular Diagnosis of Philadelphia-Positive Leukemias

The Philadelphia (Ph) chromosome was the first chromosomal abnormality associated with a specific malignant disease in humans, namely chronic myelogenous leukemia (CML).1 In 1973 the Ph chromosome was identified as one partner in a reciprocal chromosomal translocation between chromosomes 9 and 22—t(9;22)(q34;qll).2 The translocation results in the formation of two hybrid genes—BCR/ABL on the Ph chromosome and ABL/BCR on 9q+. The BCR/ABL gene seems to be the main of (probably three)3 molecular events leading to a development of CML.