Jennifer Hammes

Nuclear Exclusion of TET1 Is Associated with Loss of 5-Hydroxymethylcytosine in IDH1 Wild-Type Gliomas

The recent identification of isocitrate dehydrogenase 1 (IDH1) gene mutations in gliomas stimulated various studies to explore the molecular consequences and the clinical implications of such alterations. The Cancer Genome Atlas Research Network showed evidence for a CpG island methylator phenotype in glioblastomas that was associated with IDH1 mutations. These alterations were associated with the production of the oncometabolite, 2-hydroxyglutarate, that inhibits oxygenases [ie, ten-eleven translocation (TET) enzymes involved in the oxidation of 5-methylcytosine to 5-hydroxymethylcytosine (5hmC)]. We investigated 60 gliomas for 5hmC presence, 5-methylcytosine content, TET1 expression, and IDH1 mutation to gain insight into their relationships on a histological level. Of gliomas, 61% revealed no immunoreactivity for 5hmC, and no correlation was observed between IDH1 mutations and loss of 5hmC. Interestingly, expression of TET1 showed remarkable differences regarding overall protein levels and subcellular localization. We found a highly significant (P = 0.0007) correlation between IDH1 mutations and nuclear accumulation of TET1, but not with loss of 5hmC. Of 5hmC-negative gliomas, 70% showed either exclusive or dominant cytoplasmic expression, or no detectable TET1 protein (P = 0.0122). Our data suggest that the loss of 5hmC is a frequent event in gliomas, independent of IDH1 mutation, and may be influenced by the nuclear exclusion of TET1 from the nuclei of glioma cells.

H3F3A K27M mutation in pediatric CNS tumors: a marker for diffuse high-grade astrocytomas.

Brain tumors are one of the most common childhood malignancies. Diffuse high-grade gliomas represent approximately 10% of pediatric brain tumors. Exon sequencing has identified a mutation in K27M of the histone H3.3 gene (H3F3A K27M and G34R/V) in about 20% of pediatric glioblastomas, but it remains to be seen whether these mutations can be considered specific for pediatric diffuse high-grade astrocytomas or also occur in other pediatric brain tumors. We performed a pyrosequencing-based analysis for the identification of H3F3A codon 27 and codon 34 mutations in 338 pediatric brain tumors. The K27M mutation occurred in 35 of 129 glioblastomas (27.1%) and in 5 of 28 (17.9%) anaplastic astrocytomas. None of the other tumor entities showed H3F3A K27M mutation. Because H3F3A K27M mutations occur exclusively in pediatric diffuse high-grade astrocytomas, analysis of codon 27 mutational status could be useful in the differential diagnosis of these neoplasms.

A Pyrosequencing-Based Assay for the Rapid Detection of IDH1 Mutations in Clinical Samples

Mutations of both the IDH1 and IDH2 (isocitratedehydrogenase enzyme 1 and 2) genes have recently been described in cases of human glioma. Since IDH1 mutations have been associated with better clinical outcome, they are suitable predictive markers for adult glioma patients. We have developed a pyrosequencing assay that allows both the sensitive and rapid detection of mutant IDH1 alleles in DNA extracted from formalin-fixed, paraffin-embedded tissues. PCR products that span exon 4 of IDH1 were used as a template for pyrosequencing. For validation, PCR products were additionally cloned and sequenced conventionally by Sanger sequencing. Sensitivity was measured by titration of wild-type and mutant sequences. PCR kinetic experiments were performed to investigate the influences of PCR cycle number on the accuracy of the assay. We found that a minimum of 5% of mutant IDH1 alleles can easily be detected with the pyrosequencing approach. So far, there are few data regarding IDH1 mutation status in high-grade gliomas of childhood. Therefore, we applied this assay to 47 pediatric high-grade glioma samples (age range 6 weeks to 23 years). Mutations were found in 5/14 astrocytoma III and in 6/33 glioblastomas. In conclusion, we have developed a pyrosequencing-based assay for the detection of mutations at the hotspot regions of IDH1 and provide proof for its applicability as a molecular diagnostic assay for clinical samples.

FGFR1 mutations in Rosette-forming glioneuronal tumors of the fourth ventricle.

Rosette-forming glioneuronal tumors (RGNTs) are rare glioneuronal tumors of the fourth ventricle region that preferentially affect young adults. Despite their histologic similarity with pilocytic astrocytomas (PAs), RGNTs do not harbor KIAA1549-BRAF fusions or BRAF mutations, which represent the most common genetic alteration in PAs. Recently, mutations affecting the hotspot codons Asn546 and Lys656 of fibroblast growth factor receptor 1 (FGFR1) have been described in PAs. They are considered to be the most frequent mechanism of mitogen-activated protein kinase activation, alternative to KIAA1549-BRAF fusion and BRAF mutations. To uncover possible molecular similarities between RGNTs and PAs, we performed a mutational study of FGFR1 in 8 RGNTs. An FGFR1 N546K mutation and an FGFR1 K656E mutation were found in the tumors of 2 patients. Notably, the patient with an FGFR1 K656E mutated RGNT had undergone a resection of a diencephalic pilocytic astrocytoma with pilomyxoid features 5 years before the discovery of the fourth ventricle tumor; the mutational analysis uncovered the presence of the same FGFR1 K656E mutation in the diencephalic tumor. These results indicate that, in addition to histologic similarities, at least a subgroup of RGNTs may show close molecular relationships with PAs. Whether FGFR1 mutated RGNTs represent a specific subset of this rare tumor entity remains to be determined.

GNA11 and N-RAS mutations: alternatives for MAPK pathway activating GNAQ mutations in primary melanocytic tumours of the central nervous system.

M. Gessi, J. Hammes, L. Lauriola, E. Dörner, J. Kirfel, G. Kristiansen, A. zur Muehlen, D. Denkhaus, A. Waha and T. Pietsch (2013) Neuropathology and Applied Neurobiology39, 417–425

Genetic Analysis of Diffuse High-Grade Astrocytomas in Infancy Defines a Novel Molecular Entity

Pediatric high‐grade gliomas are considered to be different when compared to adult high‐grade gliomas in their pathogenesis and biological behavior. Recently, common genetic alterations, including mutations in the H3F3A/ATRX/DAXX pathway, have been described in approximately 30% of the pediatric cases. However, only few cases of infant high‐grade gliomas have been analyzed so far. We investigated the molecular features of 35 infants with diffuse high‐grade astrocytomas, including 8 anaplastic astrocytomas [World Health Organization (WHO) grade III] and 27 glioblastomas (WHO grade IV) by immunohistochemistry, multiplex ligation probe‐dependent amplification (MLPA), pyrosequencing of glioma‐associated genes and molecular inversion probe (MIP) assay. MIP and MLPA analyses showed that chromosomal alterations are significantly less frequent in infants compared with high‐grade gliomas in older children and adults. We only identified H3F3A K27M in 2 of 34 cases (5.9%), with both tumors located in the posterior fossa. PDGFRA amplifications were absent, and CDKN2A loss could be observed only in two cases. Conversely, 1q gain (22.7%) and 6q loss (18.2%) were identified in a subgroup of tumors. Loss of SNORD located on chromosome 14q32 was observed in 27.3% of the infant tumors, a focal copy number change not previously described in gliomas. Our findings indicate that infant high‐grade gliomas appear to represent a distinct genetic entity suggesting a different pathogenesis and biological behavior.

Absence of TERT promoter mutations in primary melanocytic tumours of the central nervous system.

Telomerase reverse transcriptase (TERT) encodes the catalytic subunit of telomerase, which adds telomere repeats to chromosome ends, enabling repeated rounds of cell replication without cells becoming genetically instable and apoptotic or senescent [1–3]. Recent studies uncovered C > T mutations at Chr.5.1295228 and Chr.5.1295250, further referred to as C228 and C250, respectively, in the TERT promoter region in different human cancers, including hepatocellular carcinomas, thyroid cancer, bladder cancer, gliomas and skin melanomas [1–3]. These mutations appear to increase TERT transcriptional activity, by creating ETS transcription factor binding sites. Killela et al. proposed that TERT promoter mutations may be more common in cancers derived from terminally differentiated cells with low self-renewing capacity, whereas rapidly renewing tissues have alternative mechanisms to maintain telomerase lengthening [3]. The incidence of TERT mutations in skin melanoma and melanoma cell lines appears to be very high, up to 70% of the cases examined, and seems to exceed the cumulative frequency of BRAF and NRAS mutations. However, it is still to be determined whether TERT mutations can occur in other melanoma variants. While a recent study showed the absence of TERT promoter mutations in ocular melanomas, no information regarding its mutational status in primary melanocytic tumours of the central nervous system is available [4]. Primary melanocytic tumours occurring in the central nervous system (CNS) are rare neoplasms [5,6]. Histologically, they represent a spectrum of lesions ranging from welldifferentiated melanocytomas to malignant melanomas [5,6]. They are believed to derive from melanocytes normally present in the leptomeninges and share molecular and histological features with uveal melanomas. FFPE tissues corresponding to 25 primary and 3 relapsing primary melanocytic tumours of the CNS (8 melanocytomas, 18 melanocytomas of intermediate grade and 2 melanomas respectively) arising in 25 patients (13 male and 12 female; age range 20–77; mean age 53.7 years), 2 melanotic schwannomas and 23 brain metastases of systemic, non-CNS melanomas (13 male and 10 female; mean age: 58,08; age range 37–78) were retrieved from the Institute of Neuropathology, University of Bonn, Germany, from the DGNN German Brain Tumor Reference Center, Bonn, Germany, from the Institute of Neuropathology, University Duisburg-Essen, Germany, from the Department of Pathology, Catholic University, Rome, Italy, and from the Department of Neuropathology, Royal Prince Alfred Hospital, Sydney, Australia. All tumours were classified according the 2007 WHO classification of CNS tumours [5]. Moreover, 10 uveal melanoma FFPE tissues (5 male, 5 female; age range 29–84, years; mean age 55,4 years) were provided from the Institute of Pathology, University of Messina, Italy and from the Section of Anatomic Pathology, University of Catania, Italy. The study was performed in accordance with the guidelines of the ethical policies of the involved institutions. In particular, the specimens from the Royal Prince Alfred Hospital (RPAH) were collected under an RPAH Human Research Ethics Committee approval. After assignment of the required information to the samples, these have been anonymized. For mutation analysis of the TERT promoter hotspots (C228 and C250) we developed a pyrosequencing assay (Figure 1). The DNA from FFPE tumour tissue was extracted using the QIAamp DNA Mini Tissue Kit (Qiagen, Düsseldorf, Germany) according to the manufacturer’s instructions. A 169 bp fragment of the 5′ region of TERT containing the C228 and C250 coding region was amplified using the primers TERT fwd 5′-CCTGCCCCTTCACCTTCCAG-3′ and TERT rev 5′-biotinAGGACGCAGCGCTGCCTGAA-3′ using 50 ng genomic DNA as template. For pyrosequencing the primer TERT Py-5′-ACCCCGCCCCGTCCCGACCCC-3′ was used with the nucleotide dispensation order GTCGTCCGCATGCCTC to sequence TT/CCCGGGTCCCCGGCCCAGCCCCT/CTCCG. Ten glioblastomas harbouring TERT promoter (C228 or C250) mutations have been used as positive controls (Figure 1); The GNAQ, GNA11 (hotspot codon 209) and NRAS (exons 2 and 3) have been analysed for the presence of mutations as previously described [7]. None of the primary melanocytic tumours of the CNS (0/25) showed TERT promoter mutations at position

FGFR1 N546K mutation in a case of papillary glioneuronal tumor (PGNT)

using the QIAamp DNA Mini Tissue Kit (Qiagen, Dusseldorf, Germany) according to manufacturer’s instructions. Mutational analysis of FGFR1 hotspots (c.546 and c.656) was performed using a pyrosequencing assay. Briefly, 264and 226-bp fragments of FGFR1 covering hotspot codons 546 and 656, respectively, were amplified using the following primers: FGFR1(c.546) fwd 5′-CGGACGCAACAGA GAAAGACTT-3′, FGFR1(c.546) rev 5′-biotin-CCCAGAT CCCGAGATAACACA-3′, FGFR1(c.656) fwd 5′-biotin-CT CGCACGGGACATTCAC-3′ and FGFR1(c.656) rev 5′-GG TGCCATCCACTTCACA-3′. For FGFR1 c.546 and c. 656, the pyrosequencing primers py-5′-AAGCATAAGAATATC ATCATCAA-3′ and py-5′-CACTCACGTTGGTTGTC-3′ were used, respectively. As positive controls DNA of FGFR1-mutated pilocytic astrocytomas were used. The pyrosequencing analysis of the two hotspots of the FGFR1 gene revealed at codon 546 an AAC->AAA substitution corresponding to an Asn->Lys mutation (Fig. 1g). A wt sequence was otherwise found at codon 656 of FGFR1. On the other hand, the tumor showed neither BRAF, nor H3F3A (K27M or G34V/R) mutations. Notably, the tumor was focally immunoreactive with an antibody against phospho-FGFr1 protein (Fig. 1h). The fibroblast growth factor receptor (FGFr) family includes tyrosine kinases (FGFr1-2,-3,-4) sharing a common structure consisting of extracellular immunoglobulinlike domains [3]. FGFR1 amplification (chr. 8p21) has been described in different carcinoma subtypes [3]. Although FGFR1 mutations have been occasionally documented in adult glioblastoma [5], FGFR1 mutations occurring in two hotspots (Asn546 and Lys656) have been recently described in pilocytic astrocytomas [2]. These mutations are now considered as a mechanism of MApK pathway activation alternative to KIAA1549-BRAF fusions and BRAF mutations. These mutations have not been described papillary glioneuronal tumors (pGNTs) are rare neoplasms affecting young adults, that usually are characterized by an indolent clinical behavior. They are often cystic and arise in the temporal lobe or in the periventricular white matter. Histologically, pGNTs are described in the revised WHO classification (2007) as a biphasic neoplasm characterized by papillary or pseudo-papillary architecture, formed by glial cells and an intervening neuronal component with cells ranging from neurocytes to ganglion cells [4]. Information regarding their molecular features is relatively limited [4]. In this report, we describe for the first time the presence of a N546K mutation of FGFR1 gene in a pGNT arising in the frontal lobe. A 33-year-old male patient presented a 5-cm large left frontal tumor (Fig. 1a). MrI scans revealed a contrast enhancing multi-cystic, septated and partly calcified lesion, causing moderate edema in the surrounding brain tissue. Histologically, the tumor presented a papillary architecture: Map2c, s100, Olig-2 and GFAp positive tumor cells appeared to be disposed around and between hyalinized vessels (Fig. 1b–d). Intermingled between the vascular structures and glial cells, NeuN-positive neuronal elements with neurocytic cytology were detected (Fig. 1e). Few irregularly shaped ganglion cells were also seen. The tumor matrix between the vessels appeared focally myxoid and moderately alcianophilic. Between the papillary structured areas, more compact tumor parts with numerous eosinophilic granular bodies were found. small calcifications were present. Tumor cells appeared strongly positive in the immunostaining with an antibody against phosphoerK (Fig. 1f). DNA from FFpe tumor tissue was extracted

Genome-wide DNA copy number analysis of desmoplastic infantile astrocytomas and desmoplastic infantile gangliogliomas.

Little is known about the molecular features of desmoplastic infantile ganglioglioma (DIG) and desmoplastic infantile astrocytoma (DIA). We performed a genome-wide DNA copy number analysis in combination with a multiplex ligation-dependent probe amplification-based analysis of copy number changes of candidate genes in 4 DIAs and 10 DIGs. Molecular inversion probe (MIP) assay showed that large chromosomal alterations were rare among DIG and DIA. Focal recurrent genomic losses were observed in chromosome regions such as 5q13.3, 21q22.11, and 10q21.3 in both DIA and DIG. Principal component analysis did not show any significant differences between the molecular profiles of DIG and DIA, and a hierarchical cluster analysis did not clearly separate the 2 tumor groups according to their molecular profiles. In 6 cases, gain of genomic material at 7q31 (corresponding to MET gene) was found in multiplex ligation-dependent probe amplification (MLPA) analysis. Furthermore, two cases showed gain at 4q12, and a single case showed BRAF mutation. In agreement with previous analyses, this study demonstrates the absence of consistent recurrent chromosomal alterations in DIA and DIG and overall rarity of the BRAF mutation in these tumors. Notably, these results suggest that DIA and DIG represent a histologic spectrum of the same tumor rather than 2 separate entities.

Frequent epigenetic inactivation of the chaperone SGNE1/7B2 in human gliomas.

In a genome‐wide screen using DMH (differential methylation hybridization) we have identified a CpG island within the 5′ region and untranslated first exon of the secretory granule neuroendocrine protein 1 gene (SGNE1/7B2) that showed hypermethylation in low‐ and high‐grade astrocytomas compared to normal brain tissue. Pyrosequencing was performed to confirm the methylation status of this CpG island in 89 astrocytic gliomas of different malignancy grades and six glioma cell lines. Hypermethylation of SGNE1/7B2 was significantly more frequent in diffuse low‐grade astrocytomas as well as secondary glioblastomas and anaplastic astrocytomas as compared to primary glioblastomas. mRNA expression analysis by real‐time RT‐PCR indicates that SGNE1/7B2 expression is downregulated in astrocytic gliomas compared to white matter samples. Treatment of glioma cells with the demethylating agent 5‐aza‐2′‐deoxycytidine restores the transcription of SGNE1/7B2. Overexpression of SGNE1/7B2 in T98G, A172 and U373MG glioblastoma cells significantly suppressed focus formation and led to a significant increase in apoptotic cells as determined by flow cytometric analysis in T98G cells. In summary, we have identified SGNE1/7B2 as a novel target silenced by DNA methylation in astrocytic gliomas. The high incidence of this alteration and the significant effects of SGNE1/7B2 on the growth and apoptosis of glioblastoma cells provide a first proof for a functional implication of SGNE1/7B2 inactivation in the molecular pathology of gliomas.