Jlenia Marchesini

Short- Versus Long-Term Duration of Dual-Antiplatelet Therapy After Coronary Stenting A Randomized Multicenter Trial

Background— The optimal duration of dual-antiplatelet therapy and the risk-benefit ratio for long-term dual-antiplatelet therapy after coronary stenting remain poorly defined. We evaluated the impact of up to 6 versus 24 months of dual-antiplatelet therapy in a broad all-comers patient population receiving a balanced proportion of Food and Drug Administration–approved drug-eluting or bare-metal stents. Methods and Results— We randomly assigned 2013 patients to receive bare-metal, zotarolimus-eluting, paclitaxel-eluting, or everolimus-eluting stent implantation. At 30 days, patients in each stent group were randomly allocated to receive up to 6 or 24 months of clopidogrel therapy in addition to aspirin. The primary end point was a composite of death of any cause, myocardial infarction, or cerebrovascular accident. The cumulative risk of the primary outcome at 2 years was 10.1% with 24-month dual-antiplatelet therapy compared with 10.0% with 6-month dual-antiplatelet therapy (hazard ratio, 0.98; 95% confidence interval, 0.74–1.29; P=0.91). The individual risks of death, myocardial infarction, cerebrovascular accident, or stent thrombosis did not differ between the study groups; however, there was a consistently greater risk of hemorrhage in the 24-month clopidogrel group according to all prespecified bleeding definitions, including the recently proposed Bleeding Academic Research Consortium classification. Conclusions— A regimen of 24 months of clopidogrel therapy in patients who had received a balanced mixture of drug-eluting or bare-metal stents was not significantly more effective than a 6-month clopidogrel regimen in reducing the composite of death due to any cause, myocardial infarction, or cerebrovascular accident. Clinical Trial Registration— URL: http://www.clinicaltrials.gov. Unique identifier: NCT00611286.

Randomized comparison of 6- versus 24-month clopidogrel therapy after balancing anti-intimal hyperplasia stent potency in all-comer patients undergoing percutaneous coronary intervention: Design and rationale for the PROlonging Dual-antiplatelet treatment after Grading stent-induced Intimal hyperplasia study (PRODIGY)

BACKGROUND The optimal duration of clopidogrel therapy after coronary stenting is debated because of the scarcity of randomized controlled trials and inconsistencies arising from registry data. Although prolonged clopidogrel therapy after bare metal stenting is regarded as an effective secondary prevention measure, the safety profile of drug-eluting stents itself has been questioned in patients not receiving ≥ 12 months of dual-antiplatelet therapy. HYPOTHESIS Twenty-four months of clopidogrel therapy after coronary stenting reduces the composite of death, myocardial infarction, or stroke compared with 6 months of treatment. STUDY DESIGN PRODIGY is an unblinded, multicenter, 4-by-2 randomized trial. All-comer patients with indication to coronary stenting are randomly treated-balancing randomization-with bare metal stent (no active late loss inhibition), Endeavor Sprint zotarolimus-eluting stent (Medtronic, Santa Rosa, CA) (mild late loss inhibition), Taxus paclitaxel-eluting stent (Boston Scientific, Natick, MA) (moderate late loss inhibition), or Xience V everolimus-eluting stent (Abbott Vascular, Santa Clara, CA) (high late loss inhibition). At 30 days, patients in each stent group are randomly allocated to receive 24 or up to 6 months of clopidogrel therapy-primary end point randomization. With 1,700 individuals, this study will have >80% power to detect a 40% difference in the primary end point after sample size augmentation of 5% and a background event rate of 8%. SUMMARY The PRODIGY trial aims to assess whether 24 months of clopidogrel therapy improves cardiovascular outcomes after coronary intervention in a broad all-comer patient population receiving a balanced mixture of stents with various anti-intimal hyperplasia potency.

Two-Year Outcomes After First- or Second-Generation Drug-Eluting or Bare-Metal Stent Implantation in All-Comer Patients Undergoing Percutaneous Coronary Intervention : A Pre-Specified Analysis From the PRODIGY Study (PROlonging Dual Antiplatelet Treatment After Grading stent-induced Intimal hyperplasia studY)

OBJECTIVES This study sought to assess device-specific outcomes after implantation of bare-metal stents (BMS), zotarolimus-eluting Endeavor Sprint stents (ZES-S), paclitaxel-eluting stents (PES), or everolimus-eluting stents (EES) (Medtronic Cardiovascular, Santa Rosa, California) in all-comer patients undergoing percutaneous coronary intervention. BACKGROUND Few studies have directly compared second-generation drug-eluting stents with each other or with BMS. METHODS We randomized 2,013 patients to BMS, ZES-S, PES, or EES implantation. At 30 days, each stent group received up to 6 or 24 months of clopidogrel therapy. The key efficacy endpoint was the 2-year major adverse cardiac event (MACE) including any death, myocardial infarction, or target vessel revascularization, whereas the cumulative rate of definite or probable stent thrombosis (ST) was the key safety endpoint. RESULTS Clinical follow-up at 2 years was complete for 99.7% of patients. The MACE rate was lowest in EES (19.2%; 95% confidence interval [CI]: 16.0 to 22.8), highest in BMS (32.1%; 95% CI: 28.1 to 36.3), and intermediate in PES (26.2%; 95% CI: 22.5 to 30.2) and ZES-S (27.8%; 95% CI: 24.1 to 31.9) groups (chi-square test = 18.9, p = 0.00029). The 2-year incidence of ST in the EES group (1%; 95% CI: 0.4 to 2.2) was similar to that in the ZES-S group (1.4%; 95% CI: 0.7 to 2.8), whereas it was lower compared with the PES (4.6%, 95% CI: 3.1 to 6.8) and BMS (3.6%; 95% CI: 2.4 to 5.6) groups (chi-square = 16.9; p = 0.0001). CONCLUSIONS Our study shows that cumulative MACE rate, encompassing both safety and efficacy endpoints, was lowest for EES, highest for BMS, and intermediate for PES and ZES-S groups. EES outperformed BMS also with respect to the safety endpoints with regard to definite or probable and definite, probable, or possible ST. (PROlonging Dual antiplatelet treatment after Grading stent-induced Intimal hyperplasia studY [PRODIGY]; NCT00611286).

Pluripotent Stem Cell miRNAs and Metastasis in Invasive Breast Cancer

BACKGROUND The purpose of this study is to determine whether microRNA for pluripotent stem cells are also expressed in breast cancer and are associated with metastasis and outcome. METHODS We studied global microRNA profiles during differentiation of human embryonic stem cells (n =26) and in breast cancer patients (n = 33) and human cell lines (n = 35). Using in situ hybridization, we then investigated MIR302 expression in 318 untreated breast cancer patients (test cohort, n = 22 and validation cohort, n = 296). In parallel, using next-generation sequencing data from breast cancer patients (n = 684), we assessed microRNA association with stem cell markers. All statistical tests were two-sided. RESULTS In healthy tissues, the MIR302 (high)/MIR203 (low) asymmetry was exclusive for pluripotent stem cells. MIR302 was expressed in a small population of cancer cells within invasive ductal carcinoma, but not in normal breast (P < .001). Furthermore, MIR302 was expressed in the tumor cells together with stem cell markers, such as CD44 and BMI1. Conversely, MIR203 expression in 684 breast tumors negatively correlated with CD44 (Spearman correlation, Rho = -0.08, P = .04) and BMI1 (Rho = -0.11, P = .004), but positively correlated with differentiation marker CD24 (Rho = 0.15, P < .001). Primary tumors with lymph node metastasis had cancer cells showing scattered expression of MIR302 and widespread repression of MIR203. Finally, overall survival was statistically significantly shorter in patients with MIR302-positive cancer cells (P = .03). CONCLUSIONS In healthy tissues the MIR302(high)/MIR203(low) asymmetry was characteristic of embryonic and induced pluripotency. In invasive ductal carcinoma, the MIR302/MIR203 asymmetry was associated with stem cell markers, metastasis, and shorter survival.

Prognostic Impact of Hospital Readmissions After Primary Percutaneous Coronary Intervention

The implementation of primary percutaneous coronary intervention (PCI) has significantly improved the clinical outcome of patients admitted for ST-segment elevation myocardial infarction (STEMI).1 However, some patients still develop recurrent adverse events, with a negative impact on survival. Accordingly, we analyzed the data from the REAL (Registro Angioplastiche dell’Emilia-Romagna) registry in order to evaluate the 3-year readmission rate for cardiovascular causes and their influence on death. Methods For all patients with STEMI (from January 2003 to June 2009) undergoing primary PCI enrolled in the REAL registry,2-4 we evaluated the incidence of death and hospital readmission due to cardiovascular causes up to 3 years. Particularly, myocardial infarction (MI), coronary revascularization (CR), acute or congestive heart failure (HF), and serious bleeding events […]

Analysis of osteoblast-like MG63 cells' response to a rough implant surface by means of DNA microarray.

Several features of the implant surface, such as composition, topography, roughness, and energy, play a relevant role in implant integration with bone. Little is known about the structural and chemical surface properties that may influence biological responses. Expression profiling by DNA microarray is a molecular technology that allows the analysis of gene expression in a cell system. By using DNA microarrays containing 19200 genes, we identified several genes whose expression was significantly down-regulated in osteoblast-like cell line MG63 on a new implant surface (titanium pull spray superficial [TPSS] surface, Oralplant, Cordenons, PN, Italy). The differentially expressed genes cover a broad range of functional activities: (1) signaling transduction, (2) translation, (3) cell cycle regulation, (4) structural and metabolic functions, and (5) apoptosis. It was also possible to detect some genes whose functions are unknown. The data reported can be relevant to better understand the role of the type of surface on the molecular mechanism of implant osseointegration and as a model for comparing other materials.

Study of the PVRL1 Gene in Italian Nonsyndromic Cleft Lip Patients with or without Cleft Palate

Nonsyndromic cleft lip with or without cleft palate (CL/P) is a complex genetic trait and little is known about its aetiology. Recent investigations on rare clefting syndromes provided interesting clues about genes involved in face development. The PVRL1 gene encodes nectin1, a cell‐to‐cell adhesion molecule. Mutations in its sequence have been shown to cause the rare autosomal recessive syndrome CL/P‐ectodermal dysplasia syndrome (CLPED1), while heterozygosity for the mutation W185X seemed to increase the risk of non syndromic CL/P in a population from northern Venezuela. In the present study, we screened 143 Italian CL/P patients for mutations in PVRL1. Three rare sequence variants in exon 3 that create amino‐acid changes were detected in a total of 7 patients. Two of these mutations were not found in a panel of 292 unaffected controls, while the third was found in two controls. This study describes new mutations that may represent genetic risk factors for CL/P. Even though a study to look at the effects of the mutations on nectin1 function was not feasible, supporting evidence was reported, thus confirming the involvement of PVRL1 in the aetiology of non‐syndromic CL/P malformation.

ACE Inhibition Modulates Endothelial Apoptosis and Renewal via Endothelial Progenitor Cells in Patients with Acute Coronary Syndromes

BackgroundThe equilibrium between endothelial apoptosis and endothelial renewal is altered in acute coronary syndromes and may be related to differences in the beneficial effects of angiotensin-converting enzyme inhibitors and angiotensin II receptor antagonists (angiotensin receptor blockers).MethodsWe evaluated the effect of treatment on endothelial function in post-myocardial infarction (MI) patients treated with perindopril (group 2, n = 16) or valsartan (group 3, n = 17) at baseline and after 7, 15, and 30 days and in normal controls (group 1, n = 20). Endothelial apoptosis was determined by cultivating serum samples in vitro with human umbilical vein endothelial cells (HUVECs), while endothelial renewal was assessed by mobilization of CD34+ bone marrow cells.ResultsAt baseline, post-MI patients had significantly elevated rates of apoptosis (16.6±5.0% and 16.5±8.4% in groups 2 and 3, respectively [both p = 0.01] vs 1.6±0.7% in group 1), which declined in group 2 (10.5±4.4% at 30 days, p = 0.04), but not in group 3. Similar results and trends were found for the Bax/Bcl-2 ratio. CD34+ mobilization was significantly increased in group 2 (3.0±1.0 at baseline to 6.2±1.6 at 15 days, p = 0.03), whereas in group 3 CD34+ mobilization did not change significantly. The findings in group 2 were accompanied by an increase in vascular endothelial growth factor at 15 days, and a reduction in tumor necrosis factor-α and its soluble receptors, versus no change in group 3. Similar findings were observed for angiotensin II and bradykinin.ConclusionOur results indicate that perindopril, but not valsartan, reduces the proapoptotic effect of serum on the endothelium and increases endothelial renewal in patients with acute coronary syndromes.

Investigation of the W185X nonsense mutation of PVRL1 gene in Italian nonsyndromic cleft lip and palate patients

Nonsyndromic cleft lip with or without cleft palate (CL/P; MIM 119530), a common birth defect, is a genetically complex trait. Several genetic and environmental factors seem to be involved in the development of this malformation [Carinci et al., 2003]. Nevertheless, CL/P also occurs as a part of many single gene syndromes, and some of these genes may also have roles in nonsyndromic CL/P. Suzuki et al. [2000] showed that the rareautosomal recessive syndromeCL/P-ectodermal dysplasia (CLPED1;MIM 225060) is caused by the loss-of-function ofPVRL1 gene, which encodes nectin-1, a cell-to-cell adhesion molecule. The same group demonstrated that heterozygosity of the nonsense mutation W185X is a genetic risk factor for nonsyndromic CL/P in northern Venezuela [Sozen et al., 2001]. To verify whether the W185X mutation is a genetic risk factor for nonsyndromic CL/P in the Italian population, 71 familial CL/P belonging to 71 different pedigrees, 75 sporadic CL/P, and 100 unrelated unaffected individuals were enrolled in this study. The W185X mutation is a singlenucleotide change G!A that creates a StyI restriction endonuclease site. Therefore, a 160 bp segment of the exon 3 containing the mutation was amplified by PCR using the following primers: W185X.for 50CCACCAATTGGATAGAGGGTA30 and W185X.rev 50CGGATCTCCTGGTACTCTGC30. Amplimers were digested with StyI restriction endonuclease, electrophoresed on 2.5% agarose gel, and visualized by ethidium bromide. Positive controls, containing the mutation generated by site-directed mutagenesis (www.buckinstitute.org/benz/prot/prot12.htm), were included to verify the assay efficiency in each test. Of the 146 CL/P patients and of the 100 unaffected individuals analyzed in this study for the presence of the W185X mutation in the PVRL1 exon 3, none was positive. The results of this investigation indicate that in Italy the W185X mutation is not common and in turn, it does not constitutea risk factor fornonsyndromicCL/P.As suggestedby Suzuki et al. [2000], since the PVRL1 gene product constitutes a receptor for herpesviruses, in the Margarita Island population the mutation may be selected positively for an increased resistance to infections of the carriers. Our findings significantly differ from those previously observed in the Venezuelan population [Sozen et al., 2001]. This discrepancy likely reflects the complex etiology of the CL/P malformation. Indeed, the numerous genetic and environmental factors involved probably contribute differently to the development of the malformation in distinct populations. REFERENCES

Cleft lip with or without cleft palate: implication of the heavy chain of non-muscle myosin IIA

Non-syndromic cleft lip with or without palate (CL/P) is one of the most common malformations among live births, but most of the genetic components and environmental factors involved remain to be identified. Among the different causes, MYH9, the gene encoding for the heavy chain of non-muscle myosin IIA, was considered a potential candidate, because it was found to be abundantly and specifically expressed in epithelial cells of palatal shelves before fusion. After fusion, its expression level was shown to decrease and to become limited to epithelial triangles before disappearing, as fusion is completed. To determine whether MYH9 plays a role in CL/P aetiology, a family-based association analysis was performed in 218 case/parent triads using single-nucleotide polymorphism (SNP) markers. Pairwise and multilocus haplotype analyses identified linkage disequilibrium between polymorphism alleles at the MYH9 locus and the disease. The strongest deviation from a null hypothesis of random sharing was obtained with two adjacent SNPs, rs3752462 and rs2009930 (global p value  = 0.001), indicating that MYH9 might be a predisposing factor for CL/P, although its pathogenetic role needs to be investigated more accurately.