Furio Pezzetti

Strong Evidence of Linkage Disequilibrium between Polymorphisms at the IRF6 Locus and Nonsyndromic Cleft Lip With or Without Cleft Palate, in an Italian Population

Cleft lip with or without cleft palate (CL/P) is one of the most common birth defects, but its etiology is largely unknown. It is very likely that both genetic and environmental factors contribute to this malformation. Mutations in the gene for interferon regulatory factor 6 (IRF6) have been shown to be the cause of Van der Woude syndrome, a dominant disorder that has CL/P as a common feature. Recently, it has been reported that genetic polymorphisms at the IRF6 locus are associated with nonsyndromic CL/P, with stronger association in Asian and South American populations. We investigated four markers spanning the IRF6 locus, using the transmission/disequilibrium test. A sample of 219 Italian triads of patients and their parents were enrolled in the study. Strong evidence of linkage disequilibrium was found between markers and disease in both single-allele (P=.002 at marker rs2235375) and haplotype (P=.0005) analyses. These findings confirm the contribution of IRF6 in the etiology of nonsyndromic CL/P and strongly support its involvement in populations of European ancestry.

Potential markers of tongue tumor progression selected by cDNA microarray.

Squamous cell carcinoma (SCC), the most frequent malignant tumor of the oral cavity, generally exhibits a poor prognosis and metastases are the main cause of death. This tumor often arises from pre-malignant lesions. To date, it is difficult to predict if and which pre-malignant lesions may progress into oral SCC using traditional methods. For these reasons, several studies are trying to identify markers useful in the progression of pre-malignant lesions and tumors. To define the genetic expression profile of tongue tumor progression we compared 9 dysplasias (DS), 8 tumors without metastasis (TWM), 11 metastasizing SCCs (MT) of the tongue, and a baseline of 11 normal tissues by using cDNA microarray containing 19.2 K clones. We initially applied hierarchical agglomerative clustering based on information from all 6026 clones. Results were obtained by performing a two steps analysis: a Significance Analysis of Microarray (SAM) and a Gene Ontology search. One hundred and five clones have statistically significant different expression levels (FDR <0.01) between DS and TWM, whereas 570 genes have statistically significant difference expression levels between TWM and MT (FDR <0.01) as detected by SAM. By filtering with FatiGo only 33 genes were differentially expressed in TWN, respect to DS, whereas 155 genes were differentially expressed in MT respect to TWM. We detected some genes which encode for oncogenes, transcription factors and cell cycle regulators as potential markers of DS progression. Examples are BAG4, PAX3 and CCNI, respectively. Among potential markers of metastases are some genes related to cell mobility (TSPAN-2 and SNTA1), intercellular adhesion (integrin alpha 7) or extracellular matrix components (ADAMTS2 and cathepsin O). Additionally, under-expressed genes encoded apoptosis-related proteins (PDCD4 and CASP4). In conclusion, we identified several genes differentially expressed in tumor progression which can potentially help in better classifying premalignant lesions and tongue SCCs.

P253R fibroblast growth factor receptor‐2 mutation induces RUNX2 transcript variants and calvarial osteoblast differentiation

Unregulated fibroblast growth factor 2 (FGF2) signaling caused by mutations in the fibroblast growth factor receptor (FGFR2) leads to human craniosynostosis such as the Apert syndrome. In an in vitro control model of calvarial osteoblasts from Apert patients carrying the FGFR2 P253R mutation, we studied the changes in cellular phenotype and evaluated the effects of FGF2. Compared with wild‐type controls, osteocalcin mRNA was down‐regulated in Apert osteoblasts, Runt‐related transcription factor‐2 (RUNX2) mRNA was differentially spliced, and FGF2 secretion was greater. Total protein synthesis, fibronectin and type I collagen secretion were up‐regulated, while protease and glycosidase activities and matrix metalloproteinase‐13 (MMP‐13) transcription were decreased, suggesting an altered ECM turnover. Adding FGF2 increased protease and glycosidase activities and down‐regulated fibronectin and type I collagen secretion in Apert osteoblasts. High affinity FGF2 receptors were up‐regulated in Apert osteoblasts and analysis of signal transduction showed elevated levels of Grb2 tyrosine phosphorylation and the Grb2‐p85 beta association, which FGF2 stimulation strongly reduced. All together these findings suggest increased constitutive receptor activity in Apert mutant osteoblasts and an autocrine loop involving the FGF2 pathway in modulation of Apert osteoblast behavior.

Investigation of the W185X nonsense mutation of PVRL1 gene in Italian nonsyndromic cleft lip and palate patients

Nonsyndromic cleft lip with or without cleft palate (CL/P; MIM 119530), a common birth defect, is a genetically complex trait. Several genetic and environmental factors seem to be involved in the development of this malformation [Carinci et al., 2003]. Nevertheless, CL/P also occurs as a part of many single gene syndromes, and some of these genes may also have roles in nonsyndromic CL/P. Suzuki et al. [2000] showed that the rareautosomal recessive syndromeCL/P-ectodermal dysplasia (CLPED1;MIM 225060) is caused by the loss-of-function ofPVRL1 gene, which encodes nectin-1, a cell-to-cell adhesion molecule. The same group demonstrated that heterozygosity of the nonsense mutation W185X is a genetic risk factor for nonsyndromic CL/P in northern Venezuela [Sozen et al., 2001]. To verify whether the W185X mutation is a genetic risk factor for nonsyndromic CL/P in the Italian population, 71 familial CL/P belonging to 71 different pedigrees, 75 sporadic CL/P, and 100 unrelated unaffected individuals were enrolled in this study. The W185X mutation is a singlenucleotide change G!A that creates a StyI restriction endonuclease site. Therefore, a 160 bp segment of the exon 3 containing the mutation was amplified by PCR using the following primers: W185X.for 50CCACCAATTGGATAGAGGGTA30 and W185X.rev 50CGGATCTCCTGGTACTCTGC30. Amplimers were digested with StyI restriction endonuclease, electrophoresed on 2.5% agarose gel, and visualized by ethidium bromide. Positive controls, containing the mutation generated by site-directed mutagenesis (www.buckinstitute.org/benz/prot/prot12.htm), were included to verify the assay efficiency in each test. Of the 146 CL/P patients and of the 100 unaffected individuals analyzed in this study for the presence of the W185X mutation in the PVRL1 exon 3, none was positive. The results of this investigation indicate that in Italy the W185X mutation is not common and in turn, it does not constitutea risk factor fornonsyndromicCL/P.As suggestedby Suzuki et al. [2000], since the PVRL1 gene product constitutes a receptor for herpesviruses, in the Margarita Island population the mutation may be selected positively for an increased resistance to infections of the carriers. Our findings significantly differ from those previously observed in the Venezuelan population [Sozen et al., 2001]. This discrepancy likely reflects the complex etiology of the CL/P malformation. Indeed, the numerous genetic and environmental factors involved probably contribute differently to the development of the malformation in distinct populations. REFERENCES

Expression profiling of ameloblastic carcinoma.

Ameloblastic carcinoma (AC) is a malignant epithelial odontogenic tumor that histologically retains the features of ameloblastic differentiation and exhibits cytological features of malignancy in the primary or recurrent tumor. It may develop within a preexisting ameloblastoma or arise de novo or from an odontogenic cyst. Expression profiling by DNA microarray is a new molecular technology that allows the analysis of cell and tissue gene expression. By using DNA microarrays containing 19,200 genes, several genes whose expression was significantly upregulated or downregulated were identified in a case of AC. The differentially expressed genes cover a broad range of functional activities: 1) transcription, 2) signaling transduction, 3) cell cycle regulation, 4) apoptosis control, and 5) differentiation. The data reported are, to our knowledge, the first genetic portrait of an AC. No final conclusion can be drawn; however, this portrait will be useful in investigating the biological behavior and in identifying possible gene targets for cancer therapy when more cases of this rare tumor are reported and compared.

Genetic profiling of granular cell myoblastoma.

Granular cell tumor (GCT), or granular cell myoblastoma, is a relatively uncommon lesion of the soft tissues. It can occur in any organ, and the tongue is more often affected. GCT has unknown etiology, uncertain histogenesis, and a not always benign nature. Benign myoblastomas are the great majority, but rare malignant lesions have been reported. To have more information regarding the genetic events involved in GCT, the authors decided to perform an expression profile. A sample was derived from a surgically resected GCT of the tongue. RNA extracted from normal tongue (mucosa plus muscle) was used as control. By using DNA microarrays containing 19,200 genes, the authors identified several genes for which expression was significantly up- or down-regulated. The differentially expressed genes cover a broad range of functional activities: (1) signal transduction, (2) cell cycle regulation, and (3) cytoskeleton organization. It was also possible to detect some genes whose function is unknown. The data reported are, to the authors’ knowledge, the first genetic portrait of GCT. Mutations in some of the described genes are related to neural alterations and mental diseases, and this fact supports the idea of a neural origin of myoblastoma. Several markers have been identified that will help in identifying the biological behavior (when malignant lesions will be described), as well as the gene whose products could be potentially disease-specific targets for therapy.