L. W. Liefting

'Candidatus Phytoplasma australiense' is the phytoplasma associated with Australian grapevine yellows, papaya dieback and Phormium yellow leaf diseases

Sequence comparisons and phylogenetic analysis of the 16S rRNA genes and the 16S/23S spacer regions of the phytoplasmas associated with Australian grapevine yellows, papaya dieback and Phormium yellow leaf diseases revealed minimal nucleotide differences between them resulting in the formation of a monophyletic group. Therefore, along with Australian grapevine yellows, the phytoplasmas associated with Phormium yellow leaf and papaya dieback should also be considered as ‘Candidatus Phytoplasma australiense’.

Comparison of the complete genome sequence of two closely related isolates of ‘Candidatus Phytoplasma australiense’ reveals genome plasticity

Background‘Candidatus Phytoplasma australiense’ is associated with at least nine diseases in Australia and New Zealand. The impact of this phytoplasma is considerable, both economically and environmentally. The genome of a NZ isolate was sequenced in an effort to understand its pathogenicity and ecology. Comparison with a closely related Australian isolate enabled us to examine mechanisms of genomic rearrangement.ResultsThe complete genome sequence of a strawberry lethal yellows (SLY) isolate of ‘Candidatus Phytoplasma australiense’ was determined. It is a circular genome of 959,779 base pairs with 1126 predicted open reading frames. Despite being 80 kbp larger than another ‘Ca. Phytoplasma australiense’ isolate PAa, the variation between housekeeping genes was generally less than 1% at a nucleotide level. The difference in size between the two isolates was largely due to the number and size of potential mobile units (PMUs), which contributed to some changes in gene order. Comparison of the genomes of the two isolates revealed that the highly conserved 5′ UTR of a putative DNA-directed RNA polymerase seems to be associated with insertion and rearrangement events. Two types of PMUs have been identified on the basis of the order of three to four conserved genes, with both PMUs appearing to have been present in the last common ancestor of ‘Ca. Phytoplasma asteris’ and ‘Ca. Phytoplasma australiense’. Comparison with other phytoplasma genomes showed that modification methylases were, in general, species-specific. A putative methylase (xor IIM) found in ‘Ca. Phytoplasma australiense’ appeared to have no analogue in any other firmicute, and we believe has been introduced by way of lateral gene transfer. A putative retrostransposon (ltrA) analogous to that found in OY-M was present in both isolates, although all examples in PAa appear to be fragments. Comparative analysis identified highly conserved 5′ and 3′ UTR regions of ltrA, which may indicate how the gene is excised and inserted.ConclusionsComparison of two assembled ‘Ca. Phytoplasma australiense’ genomes has shown they possess a high level of plasticity. This comparative analysis has yielded clues as to how rearrangements occur, and the identification of sets of genes that appear to be associated with these events.

Phormium Yellow Leaf Phytoplasma Is Associated with Strawberry Lethal Yellows Disease in New Zealand

A yellows disease of strawberry plants was identified in propagation beds in New Zealand. Affected plants were flatter to the ground, showed purpling of older leaves, reduced leaf size, yellowing of younger leaves, and sometimes plant death. A phytoplasma was observed in the phloem of affected plants. The 16S rRNA gene of the phytoplasma was amplified by polymerase chain reaction from symptomatic plants and from one asymptomatic plant, but not from 36 other asymptomatic plants. Nucleotide sequence analysis of the 16S rRNA gene showed that the phytoplasma is closely related or identical to the phytoplasma associated with the yellow leaf disease of New Zealand flax (Phormium tenax).

A review of the plant virus, viroid, liberibacter and phytoplasma records for New Zealand

A complete review of the records of plant virus, viroid, liberibacter and phytoplasma in New Zealand has found evidence for 220 viruses, seven viroids, two liberibacters and two phytoplasmas. Of these, 80 viruses, one viroid and two species of liberibacter have been reported as new to New Zealand since the last review in 2006. Ten viruses and two viroids, which were previously placed in the unconfirmed category, have now been confirmed. Based on insufficient evidence, 25 virus, three viroid, three mollicute and 36 disease records are considered unconfirmed.

The complete nucleotide sequence and genome organisation of a novel member of the family Betaflexiviridae from Actinidia chinensis

We report the complete genome sequence of a novel virus, tentatively named “actinidia seed-borne latent virus” (ASbLV), isolated from Actinidia chinensis in Auckland, New Zealand. The complete genome of ASbLV is 8,192 nucleotides long, excluding the 3ʹ poly(A) tail, contains four open reading frames, and is most closely related to Caucasus prunus virus (56% nucleotide sequence identity), a member of the genus Prunevirus. Based on the demarcation criteria of the family Betaflexiviridae, ASbLV is a new member of the genus Prunevirus.

Development of a duplex one-step RT-qPCR assay for the simultaneous detection of Apple scar skin viroid and plant RNA internal control

Apple scar skin viroid (ASSVd) is an important quarantine pathogen for international movement of pome germplasm as it can cause significant damage to pip fruit. A one-step real-time RT-PCR assay was developed for the rapid and sensitive detection of ASSVd. The assay was able to detect a wide range of ASSVd isolates and was highly specific compared to a published conventional RT-PCR. The detection limit of the new assay was estimated to be about 100 copies of the ASSVd target. The assay can be run as a duplex with the nad5 internal control primers and probe to simultaneously check the PCR competency of the samples therefore reducing the risk of false negatives. It is expected that this real-time RT-PCR assay will facilitate efficient testing for ASSVd by regulatory services, and will also have a wider use for the general detection of ASSVd in a range of pip fruit.

Diagnostic Challenges for the Detection of Emerging Pathogens: A Case Study Involving the Incursion of Pseudomonas syringae pv. actinidiae in New Zealand

In November 2010, Pseudomonas syringae pv. actinidiae (Psa) was detected for the first time in New Zealand. This finding triggered one of the largest surveillance and diagnostic programmes seen in New Zealand’s horticultural industry. During this response, over 912 kiwifruit orchards and 14,500 samples were screened and tested for the presence of Psa. The initial objectives of the response were to confirm the causal agent, determine disease prevalence and identify possible mechanisms of spread with the aim of identifying management options to contain the outbreak. Molecular diagnoses and characterisation of the Psa strains isolated during the response was conducted using a range of techniques that included qPCR, rep-PCR fingerprinting, multilocus sequence analysis, and next generation sequencing. The usefulness and challenges of using the molecular techniques available at the time for Psa detection and characterisation during the response are discussed.

First report of a carlavirus in Fuchsia spp. in New Zealand.

The genus Fuchsia has 110 known species and numerous hybrids. These ornamental plants with brightly colored flowers originate from Central and South America, New Zealand, and Tahiti, but a wider variety are now grown all over the world. Few viruses have been reported in Fuchsia spp.: a carlavirus, Fuchsia latent virus (FLV) (1-3), a cucumovirus, Cucumber mosaic virus (CMV) (3), and two tospoviruses, Impatiens necrotic spot virus (INSV) and Tomato spotted wilt virus (TSWV) (4). In August 2009, five plants, each representing a different cultivar of Fuchsia hybrid, from home gardens in the Auckland and Southland regions of New Zealand, displayed variable symptoms including mild chlorosis, mild mottle, or purple spots on leaves. Plants tested negative for CMV, INSV, and TSWV using commercial ImmunoStrips (Agdia Inc., Elkhart, IN); however, flexuous particles of ~650 to 700 nm were found by electron microscopy in all samples. Local lesions were also observed on Chenopodium quinoa plants 4 weeks after sap inoculation. Total RNA was extracted from all plants with a RNeasy Plant Mini Kit (Qiagen Inc., Doncaster, Australia) and tested by reverse transcription (RT)-PCR using two generic sets of primers (R. van der Vlugt, personal communication) designed to amplify fragments of ~730 and 550 bp of the replicase and coat protein genes of carlaviruses, respectively. Amplicons of the expected size were obtained for all samples, cloned, and at least three clones per sample were sequenced. No differences within clones from the same samples were observed (GenBank Accession Nos. HQ197672 to HQ197681). A BLASTn search of the viral replicase fragment showed the highest nucleotide identity (76%) to Potato rough dwarf virus (PRDV) (EU020009), whereas the coat protein fragment had maximum nucleotide identity (70 to 72%) to PRDV (EU020009 and DQ640311) and Potato virus P (DQ516055). Sequences obtained were also pairwise aligned using the MegAlign program (DNASTAR, Inc., Madison, WI) and results showed that the isolates had 83 to 97% identity to each other within each genome region. Further sequences (HQ197925 and HQ197926) were obtained from a Fuchsia plant originating from Belgium, a BLASTn analysis showed high nucleotide identity (84 to 99%) to the New Zealand isolates. The low genetic identity to other Carlavirus members suggests that these isolates belong to a different species from those previously sequenced. On the basis of electron microscopy and herbaceous indexing, the isolates had similar characteristics to a carlavirus reported from Fuchsia in Italy (1) and FLV reported in Canada (2). The Italian carlavirus isolate was obtained and tested with the same primers by RT-PCR. Pairwise analysis of the Italian sequences (HQ197927 and HQ197928) with the New Zealand and Belgian sequences showed between 84 and 95% similarity within each genome region. These results suggest that the carlavirus infecting these plants is the same virus, possibly FLV. To our knowledge, this is the first report of this carlavirus infecting Fuchsia spp. in New Zealand, but the virus has probably been present for some time in this country and is likely to be distributed worldwide. References: (1) G. Dellavalle et al. Acta Hortic. 432:332, 1996. (2) L. J. John et al. Acta Hortic. 110:195, 1980. (3) P. Roggero et al. Plant Pathol. 49:802, 2000. (4) R. Wick and B. Dicklow. Diseases in Fuchsia. Common Names of Plant Diseases. Online publication. The American Phytopathological Society, St. Paul, MN, 1999.

Phytoplasmas Infecting Vegetable, Pulse and Oil Crops

The present chapter provides an overview of phytoplasma diseases affecting vegetable, pulse and oil crops, with an emphasis on symptoms, geographic distribution, associated phytoplasma taxa and insect vectors. Phytoplasma diseases of these crops occur worldwide; however, the majority of reports are from North American, European and Asian countries. These diseases affect plant species belonging mostly to Apiaceae, Asteraceae, Cucurbitaceae, Fabaceae and Solanaceae. They differ considerably in geographic distribution and size of the various taxonomic groups and subgroups of the associated phytoplasmas. Subgroup 16SrI-B phytoplasmas are the prevalent agents among the main infected countries. Phytoplasmas of subgroup 16SrXII-A are widely distributed throughout Europe, whereas phytoplasmas of 16SrII group are mainly distributed in Asia and Australia and those of 16SrIII group in South America. A number of diseases are associated with genetically different phytoplasmas that induce similar symptoms in the host plants.

Corrigendum to 'Development of a duplex one-step RT-qPCR assay for the simultaneous detection of Apple scar skin viroidand plant RNA internal control' [J. Virol. Methods (2015) 100-105].

ASSVd-119F SAAAGGAGCTGCCAGCA 450 nM This study ASSVd-198F GGTGTTGAGGCCCTG 450 nM This study ASSVd-221P FAM-CTGCGCTGCCACCTACTCT-BHQ1 150 nM This study ASSVd-237P FAM-AGAGTAGGTGGCAGCGCAGC-BHQ1 150 nM This study ASSVd-P2 FAM-TGTTGAGGCCCTGYCYG-BHQplus 150 nM This study ASSVd-263R GGAGTCCGCTCGACT 500 nM This study NAD5-TM-F GCTTCTTGGGGCTTCTTGTT 150 nM Mackay, unpublished NAD5-TM-R CCAGTCACCAACATTGGCATAA 200 nM Mackay, unpublished NAD5-P Cal Red 610-AGGATCCGCATAGCCCTCG 150 nM Botermans et al. (2013) ATTTATGTG-BHQ2 AS-37 CGGTGACAAAGGAGCTGCCAG 250 nM Di Serio et al. (2002) ADAS-36 GCCTTCGTCGACGACGACAG 250 nM Di Serio et al. (2002)