Lars Allan Larsen

High-throughput single-strand conformation polymorphism analysis by automated capillary electrophoresis: robust multiplex analysis and pattern-based identification of allelic variants.

Genetic diagnosis of an inherited disease or cancer often involves analysis for unknown point mutations in several genes; therefore, rapid and automated techniques that can process a large number of samples are needed. We describe a method for high‐throughput single‐strand conformation polymorphism (SSCP) analysis using automated capillary electrophoresis. The operating temperature of a commercially available capillary electrophoresis instrument (ABI PRISM 310) was expanded by installation of a cheap in‐house designed cooling system, thereby allowing us to perform automated SSCP analysis at 14–45°C. We have used the method for detection of point mutations associated with the inherited cardiac disorders long QT syndrome (LQTS) and hypertrophic cardiomyopathy (HCM). The sensitivity of the method was 100% when 34 different point mutations were analyzed, including two previously unpublished LQTS‐associated mutations (F157C in KVLQT1 and G572R in HERG), as well as eight novel normal variants in HERG and MYH7. The analyzed polymerase chain reaction (PCR) fragments ranged in size from 166 to 1,223 bp. Seventeen different sequence contexts were analyzed. Three different electrophoresis temperatures were used to obtain 100% sensitivity. Two mutants could not be detected at temperatures greater than 20°C. The method has a high resolution and good reproducibility and is very robust, making multiplex SSCP analysis and pattern‐based identification of known allelic variants as single nucleotide polymorphisms (SNPs) possible. These possibilities, combined with automation and short analysis time, make the method suitable for high‐throughput tasks, such as genetic screening. Hum Mutat 13:318–327, 1999.

Mutational spectrum in the cardioauditory syndrome of Jervell and Lange-Nielsen.

Abstract. Jervell and Lange-Nielsen syndrome (JLNS) is an autosomal recessive syndrome characterised by profound congenital sensorineural deafness and prolongation of the QT interval on the electrocardiogram, representing abnormal ventricular repolarisation. In a study of ten British and Norwegian families with JLNS, we have identified all of the mutations in the KCNQ1 gene, including two that are novel. Of the nine mutations identified in this group of 10 families, five are nonsense or frameshift mutations. Truncation of the protein proximal to the recently identified C-terminal assembly domain is expected to preclude assembly of KCNQ1 monomers into tetramers and explains the recessive inheritance of JLNS. However, study of a frameshift mutation, with a dominant effect phenotypically, suggests the presence of another assembly domain nearer to the N-terminus.

A single strand conformation polymorphism/heteroduplex (SSCP/HD) method for detection of mutations in 15 exons of the KVLQT1 gene, associated with long QT syndrome.

Congenital long QT syndrome (LQTS) is characterised by prolongation of the QT interval on ECG and cardiac arrhythmias, syncopes and sudden death. A rapid and reliable genetic diagnosis of the disease may be of great importance for diagnosis and treatment of LQTS. Mutations in the KVLQT1 gene, encoding a potassium-channel subunit of importance for the depolarisation of cardiac myocytes, is believed to be associated with 50% of all LQTS cases. Our data confirms that KvLQT1 isoform 1 is encoded by 16 exons, and not 15, as reported previously. We have used genomic DNA sequences to design intronic PCR primers for amplification of 15 exons of KVLQT1 and optimised a non-radioactive single stranded conformation polymorphism/heteroduplex (SSCP/HD) method for detection of mutations in KVLQT1. The sensitivity of the method was 100% when it was tested on 15 in vitro constructed mutants. By multiplexing the PCR amplification of KVLQT1, it is possible to cover all 15 exons in four PCR reactions.

Outcome of clinical versus genetic family screening in hypertrophic cardiomyopathy with focus on cardiac β-myosin gene mutations

OBJECTIVEnFamilial hypertrophic cardiomyopathy (FHC) is caused by mutations in genes encoding cardiac sarcomere proteins. Although available, genetic analyses are generally not used clinically. In the present study, we evaluated the outcome of clinical vs. genetic screening of family members with specific focus on mutations in the cardiac beta-myosin heavy chain (MYH7) gene.nnnMETHODSnA consecutive cohort of 68 FHC probands and their families (395 persons) of Danish origin was evaluated including patient- and family histories, physical examinations, electrocardiogram and echocardiography. Mutation screening was performed by a combination of single strand conformation/heteroduplex analysis and direct sequencing.nnnRESULTSnEight different MYH7 gene mutations were identified in nine (13%) families (96 persons). In eight (89%) of the families, major cardiac events had occurred. Myectomy or percutaneous septal alcohol ablation had been performed in a higher number of MYH7 probands i.e. in five of nine (56%) as compared to 10 of 59 (17%) (P<0.05) non-MYH7 mutation probands. Neither echocardiographic nor ECG findings were useful to distinguish MYH7 from non-MYH7 probands. Between adult MYH7 mutation-carriers (n=38) and their non-carrier relatives (n=39), low sensitivity and specificity of the clinical diagnostic criteria tested were observed and minor clinical diagnostic criteria alone were not useful for identification of mutation carriers. By genetic screening of relatives with no or only minor hypertrophy on echocardiography, i.e. a priori possible mutation-carriers normally recommended clinical follow-up-the diagnosis was excluded in 52 (83%) persons. In addition, six relatives with secondary hypertrophy were identified as non-carriers.nnnCONCLUSIONnNeither echocardiographic nor ECG findings were useful to distinguish MYH7 from non-MYH7 probands. Extension of screening to include genetic analyses offered a marked diagnostic advantage as compared to clinical screening alone in FHC families.

Haplotype and AGG-interspersion analysis of FMR1 (CGG)n alleles in the Danish population: Implications for multiple mutational pathways towards fragile X alleles

The AGG interspersion pattern and flanking microsatellite markers and their association with instability of the FMR1 (CGG)(n) repeat, involved in the fragile X syndrome, were analyzed in DNA from filter-paper blood spots randomly collected from the Danish newborn population. Comparison of DXS548-FRAXAC1 haplotype frequencies in the normal population and among fragile X patients suggested strong linkage disequilibrium between normal alleles and haplotype 7-3 and between fragile X alleles and haplotype 2-1 and 6-4. Comparison of the AGG interspersion pattern in 143 alleles, ranging in size from 34-62 CGG, and their associated haplotypes indicates the existence of at least three mutational pathways from normal alleles toward fragile X alleles in the Danish population. Two subgroups of normal alleles, with internal sequences of (CGG)(10)AGG(CGG)(19) and (CGG)(9)AGG(CGG)(12) AGG(CGG)(9), possibly predisposed for expansion, were identified in the data set. When alleles larger than 34 CGG were investigated, comparing the length of 3 uninterrupted CGG triplets (uCGG), we found that alleles associated with haplotype 2-1 and 6-4 contain significantly longer stretches of uCGG than alleles associated with haplotype 7-3. Thus, the data support that (CGG)(n) instability is correlated to the length of uCGG.

Single-strand conformation polymorphism analysis using capillary array electrophoresis for large-scale mutation detection

This protocol describes capillary array electrophoresis single-strand conformation polymorphism (CAE-SSCP), a screening method for detection of unknown and previously identified mutations. The method detects 98% of mutations in a sample material and can be applied to any organism where the goal is to determine genetic variation. This protocol describes how to screen for mutations in 192 singleplex or up to 768 multiplex samples over 3 days. The protocol is based on the principle of sequence-specific mobility of single-stranded DNA in a native polymer, and covers all stages in the procedure, from initial DNA purification to final CAE-SSCP data analysis, as follows: DNA is purified, followed by PCR amplification using fluorescent primers. After PCR amplification, double-stranded DNA is heat-denatured to separate the strands and subsequently cooled on ice to avoid reannealing. Finally, samples are analyzed by capillary electrophoresis and appropriate analysis software.

The Val606Met mutation in the cardiac beta-myosin heavy chain gene in patients with familial hypertrophic cardiomyopathy is associated with a high risk of sudden death at young age.

F hypertrophic cardiomyopathy (FHC) is a phenotypically and genetically heterogenous myocardial disease with an autosomal dominant pattern of inheritance. FHC is a frequent cause of sudden death in young people. Knowledge of morbidity and mortality associated with different mutations in the different sarcomere genes associated with FHC may prove to be of importance for clinical decisions concerning treatment, thus, leading to improved patient management. Hence, based on genotype-phenotype analyses, mutations in the MYBPC3 encoding the cardiac myosin-binding protein C gene have generally been associated with a low morbidity and mortality early in life.1 Mutations in the TNNT2 gene encoding cardiac troponin T have been associated with a high incidence of sudden death at young age,2,3 whereas the prognosis associated with different mutations in the MYH7 gene encoding the cardiac b-myosin heavy chain (bMHC) have been more variable.2 FHC families often have their own “private” mutation, and the prognosis of FHC may vary between, as well as within, families with the same mutation, thereby compromising the value of the genotyping. The ValMet mutation is often presented as the prototype of a “benign” MYH7 gene mutation.4–7 We report the unfavorable prognosis in a family with FHC associated with the ValMet mutation in the MYH7 gene and provide cumulated data on the incidence of sudden death at young age based on the present and previously published studies. • • • From a consecutive cohort of 70 families with FHC, family JO of Danish origin was included in the present study at the The Heart Center, Rigshospitalet, University of Copenhagen. After informed consent was given (Local Science Ethics Committee, Copenhagen. Protocol No. KF V92213), patient and family histories were obtained, and physical examination, electrocardiography, and transthoracic echocardiography were performed. The clinical diagnosis of FHC in relatives was based on: (1) electrocardiographic criteria: pathologic Q-waves or signs of left ventricular hypertrophy,8,9 and/or (2) echocardiographic criteria: a maximal left ventricular wall thickness of

Long QT syndrome with a high mortality rate caused by a novel G572R missense mutation in KCNH2

13 mm,8,9 in the absence of evidence of other specific heart muscle diseases.10 For family members with disease, clinical records, family histories, or both were obtained whenever available. The clinical diagnosis was made before molecular genetic analysis. Blood samples were collected from probands and family members. Genomic DNA was extracted using a QIAamp DNA purification kit (Qiagen, Hilden, Germany). Mutation analysis of the MYH7 gene was performed using single-strand conformation polymorphism-heteroduplex (SSCP-HD) formation analysis on exons 3–23.11 Specifically for exon 16 the primers were 16F, GTGATGCTCTCTCCTGCTTCCTCA, and 16R, CCGGGAGCCTCAGTCCCTACTT. DNA preparations from 100 randomly selected Guthriecards were used as controls (Local Science Ethics Committee, Copenhagen. Protocol No. 01 to 119/99). Nucleotide sequence determination was performed by cycle sequencing using a Dye Deoxy Terminator Cycle Sequencing kit (Perkin Elmer, Foster City, California) on an ABI373 DNA sequencer (Perkin Elmer). The presently reported family, JO, were also screened for mutations in 7 other cardiac sarcomere genes known to be associated with FHC. The pedigree of family JO is shown in Figure 1. The proband (V:1, 45 years of age) was diagnosed at the age of 15 years. His previously asymptomatic son (VI:1) died suddenly at the age of 14 years. Postmortem examination confirmed the diagnosis of severe hypertrophic cardiomyopathy. The family history revealed 2 additional sudden deaths at young age (I:1 before 30 years of age and IV:1 at the age of 16 years). No additional information concerning these deaths was available. The proband’s sister (V:3, 40 years of age) has FHC, but only with few symptoms, despite pronounced septal hypertrophy and atrial fibrillation. Neither the proband’s mother nor father was available for inclusion in the study. The proband’s 2 daughters (VI:2, 23 years of age and VI:3, 16 years of age) both developed FHC during adolescence. Reports of syncope, nonsustained ventricular tachycardia on Holter monitoring, or abnormal blood pressure response during exercise, and the present family history, led to From the Department of Medicine B, The Heart Centre, Rigshospitalet, University of Copenhagen; and Department of Clinical Biochemistry, Statens Serum Institut, Copenhagen, Denmark. The study was supported by grants from The Danish Heart Foundation; The “Kong Christian den Tiendes Fond”; The Novo Nordisk Foundation; Director Emil C. Hertz and Inger Hertz’s Foundation; Danish Medical Association Research Foundation; and H:S—Copenhagen Hospital Corporation, Copenhagen, Denmark. Dr. Christiansen’s address is: Department of Clinical Biochemistry, Statens Serum Institut, 5 Artillerivej, DK-2300 S., Copenhagen, Denmark. E-mail: mic@ssi.dk. Manuscript received October 8, 2000; revised manuscript received and accepted December 28, 2000.

Analysis of FMR1 (CGG)n alleles and FRAXA microsatellite haplotypes in the population of Greenland: implications for the population of the New World from Asia.

In a four‐generation family with long QT syndrome, syncopes and torsades de pointes ventricular tachycardia (TdP) were elicited by abrupt awakening in the early morning hours. The syndrome was associated with a novel KCNH2 missense mutation, G572R, causing the substitution of a glycine residue at position 572, at the end of the S5 transmembrane segment of the HERG K+‐channel, with an arginine residue. This segment is involved in the channel pore and the mutation may cause a reduction in the rapidly activating delayed rectifier K+ current (Ikr), or changed gating properties of the ion channel, leading to prolonged cardiac repolarization. The electrocardiograms of affected persons showed prolonged QT interval and notched T waves. Despite treatment with atenolol, 200 mg twice daily, the proband still experienced TdP episodes. Three untreated relatives of the proband died suddenly, and unexpectedly, at 18, 32, and 57 years of age. The G572R mutation is thus associated with a high mortality rate, and the clinical presentation illustrates that some mutations may not be controllable by just β‐blockade.

Mutation detection by cleavase in combination with capillary electrophoresis analysis: Application to mutations causing hypertrophic cardiomyopathy and long-QT syndrome

The fragile X syndrome is caused by the expansion of a polymorphic (CGG)n tract in the promoter region of the FMR1 gene. Apparently the incidence of fragile X syndrome is rare in the population of Greenland. In order to examine population-related factors involved in stability of the (CGG)n sequence, DNA samples obtained randomly from the Greenlandic population were analysed for size and AGG interspersion pattern of the FMR1 (CGG)n region and associated DXS548-FRAXAC1 haplotypes. In addition a large Greenland family with unstable transmission in the premutation range was analysed. The (CGG)n allele sizes in the Greenland population showed a narrow distribution similar to that reported for Asian populations. DNA sequencing of alleles with 36xa0CGG repeats revealed an AGG(CGG)6 insertion previously reported exclusively in Asian populations and a high frequency of alleles with a (CGG)10AGG(CGG)9AGG(CGG)9 or (CGG)9AGG(CGG)9AGG(CGG)6AGG(CGG)9 sequence pattern was found. Thus the data confirm the Asian origin of the Greenlandic (Eskimo) population and indicates that some (CGG)n alleles have remained stable for 15–30,000 years, since the population of the New World arrived from Asia via the Bering Strait.