Lisbeth Fuxler

Studies of porcine circovirus type 2, porcine boca-like virus and torque teno virus indicate the presence of multiple viral infections in postweaning multisystemic wasting syndrome pigs.

In a previous study, using random amplification and large-scale sequencing technology, we identified a novel porcine parvovirus belonging to the genus Bocavirus in the background of porcine circovirus type 2 (PCV-2) in Swedish pigs with postweaning multisystemic wasting syndrome (PMWS). In addition to bocavirus we demonstrated the presence of torque teno virus (TTV) genogroups 1 and 2 in these cases of PMWS, indicating the simultaneous presence of several viruses in this disease complex. In the present study, 34 PMWS-affected animals and 24 pigs without PMWS were screened by PCR for the presence of PCV-2, TTV-1, TTV-2 and porcine boca-like virus (Pbo-likeV). The studies revealed the following infection rates in the PMWS-affected pigs: PCV-2 100%, TTV-1 77%, TTV-2 94% and Pbo-likeV 88%. In comparison, the pigs without PMWS had the following rates: PCV-2 80%, TTV-1 79%, TTV-2 83% and Pbo-likeV 46%. The sequence identity between the different Swedish Pbo-likeV sequences ranged between 98% and 100%. By checking co-infection, it was found that 71% of the PMWS-affected pigs harbor simultaneously all these viruses. As a contrast, in the group without PMWS only 33% of the animals were positive simultaneously for these viruses. These observations indicate a multiple viral infection in PMWS-affected pigs. It has to be studied further if the clinical manifestation of PMWS might be due to synergistic effects of different viruses acting together.

Structure-Dependent Modulation of Alpha Interferon Production by Porcine Circovirus 2 Oligodeoxyribonucleotide and CpG DNAs in Porcine Peripheral Blood Mononuclear Cells

ABSTRACT DNA sequences containing CpG motifs are recognized as immunomodulators in several species. Phosphodiester oligodeoxyribonucleotides (ODNs) representing sequences from the genome of porcine circovirus type 2 (PCV2) have been identified as potent inducers (ODN PCV2/5) or inhibitors (ODN PCV2/1) of alpha interferon (IFN-α) production by porcine peripheral blood mononuclear cells (poPBMCs) in vitro. In this study, the IFN-α-inducing or -inhibitory activities of specific phosphodiester ODNs were demonstrated to be dependent on their ability to form secondary structures. When a poly(G) sequence was added to a stimulatory self-complementary ODN, high levels of IFN-α were elicited, and the induction was not dependent on pretreatment with the transfecting agent Lipofectin. In addition, the IFN-α-inducing ODN required the presence of an intact CpG dinucleotide, whereas the inhibitory activity of ODN PCV2/1 was not affected by methylation or removal of the central CpG dinucleotide. Of particular significance, the IFN-α inhibition elicited by ODN PCV2/1 was only effective against induction stimulated by DNA control inducers and not RNA control inducers, indicating activity directed to TLR9 signaling. The PCV2 genome as a whole was demonstrated to induce IFN-α in cultures of poPBMCs, and the presence of immune modulatory sequences within the genome of PCV2 may, therefore, have implications with regard to the immune evasion mechanisms utilized by PCV2.

Experimental Infection of Ponies with Equine Influenza A2 (H3N8) Virus Strains of Different Pathogenicity Elicits Varying Interferon and Interleukin-6 Responses

The production of interferon (IFN), interleukin-6 (IL-6), and tumor necrosis factor (TNF) was monitored in horses during the course of influenza A2 virus infections. The effects of two virus strains, Newmarket/2/93 and Sussex/89, were compared, of which the latter is considered the more pathogenic in terms of clinical signs. Ten naive ponies were infected with influenza A/equine/Sussex/89 and 10 with influenza A/equine/Newmarket/2/93, respectively. As expected ponies infected with Sussex/89 showed the most pronounced clinical signs but there was no notable difference in viral excretion compared with Newmarket/2/93. IFN was detected in nasal secretions of all ponies infected with Sussex/89 but only in 2 ponies infected with Newmarktet/2/93. IFN was not detected in serum of any animal. IL-6 activity was detected in nasal secretions of all experimental animals from day 2 and onwards, but showed markedly higher IL-6 responses were observed in ponies infected with Sussex/89. No TNF activity was detected in any of the samples collected. In summary, equine influenza A 2 infections elicited local, and in some cases systemic, IFN and IL-6 responses in the ponies. Interestingly, there was some evidence that the duration and levels of cytokine responses may be related to the pathogenicity of the influenza strains.

Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-α in the pig and the phenotype of the IFN-α producing cells

Abstract The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-α (IFN-α) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-α/β producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-α production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5′ TTTTCAATTCGAAGATGAAT 3′ (ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-α. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-α induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-α without pre-incubation with lipofectin, for instance the ODN 2216 (5′ GGGGGACGATCGTCGGGGGG 3′). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-α levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-α. The identity of the IFN-α producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-α and surface markers. Approximately 1–3 IPC/103 PBMC were detected, compared to only 3 IPC/104 PBMC stimulated by Aujeszky’s disease virus. The IPC frequencies were confirmed by detection of IFN-α mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC.

Cytokine induction by immunostimulatory DNA in porcine PBMC is impaired by a hairpin forming sequence motif from the genome of Porcine Circovirus type 2 (PCV2)

Porcine Circovirus type 2 (PCV2) can cause postweaning multisystemic wasting syndrome (PMWS) in young pigs with severe immunosuppression as a major characteristic of the disease complex. Despite the dramatic involvement of the immune system, the interaction between PCV2 and the host is until date not well understood. The DNA genome of PCV2 contains sequences that in synthetic form (oligodeoxyribonucleotides; ODNs) can act immunomodulatory on porcine peripheral blood mononuclear cells (poPBMCs) in vitro. One such sequence (ODN PCV2/1) acts inhibitory on interferon (IFN)-α production induced by immunostimulatory DNA but not that induced by RNA, and the inhibitory activity is dependent on secondary structure formation. In the present study, the characteristic of ODN PCV2/1 was examined further by altering the nucleotide sequence to disrupt hairpin structure formation but still enable multimer structures through G-tetrads. This modification resulted in loss of IFN-α-inhibitory activity of the ODN and thus indicated the importance of hairpin structures. In addition, ODN PCV2/1 was compared to another inhibitory ODN (IRS 869) previously used in human and murine cells. In contrast to ODN PCV2/1, ODN IRS 869 did not inhibit IFN-α production induced by class A ODN 2216 but was a more efficient inhibitor of IFN-α production induced by plasmid DNA than ODN PCV2/1. In cultures induced by the RNA stimulator Poly I:C, however, a strong synergistic IFN-α stimulatory effect was seen in combination with ODN IRS 869. These results indicate that ODN PCV2/1 and ODN IRS 869 function through separate mechanisms to affect cytokine production by immune cells. The effect of ODN PCV2/1 was studied further by monitoring the expression of mRNA for IFN-α, IL-12p40, IL-10, IL-6, IFN-γ, IL-1β, TGF-β, and TNF-α in cultures of poPBMC stimulated with ODN 2216 or Poly I:C. Results from qPCR analyses showed that ODN PCV2/1 clearly inhibited the expression of IFN-α, IL-12p40, IL-10 and IL-6 when induced by ODN 2216, but did not seem to affect any of the cytokines examined when induced by Poly I:C. Initial studies using confocal microscopy and fluorochrome labelled ODNs indicate that ODN 2216 and ODN PCV2/1 co-localize in subpopulations of poPBMC.

Development of an in situ assay for simultaneous detection of the genomic and replicative form of PCV2 using padlock probes and rolling circle amplification

BackgroundIn this study we utilized padlock probes and rolling circle amplification as a mean to detect and study the replication of porcine circovirus type 2 (PCV2) in cultured cells and in infected tissue. Porcine circovirus type 2 is a single-stranded circular DNA virus associated with several severe diseases, porcine circovirus diseases (PCVD) in pigs, such as postweaning multisystemic wasting syndrome. The exact reason and mechanisms behind the trigger of PCV2 replication that is associated with these diseases is not well-known. The virus replicates with rolling circle replication and thus also exists as a double-stranded replicative form.ResultsBy applying padlock probes and rolling circle amplification we could not only visualise the viral genome but also discriminate between the genomic and the replicative strand in situ. The genomic strand existed in higher numbers than the replicative strand. The virus accumulated in certain nuclei but also spread into the cytoplasm of cells in the surrounding tissue. In cultured cells the average number of signals increased with time after infection.ConclusionsWe have developed a method for detection of both strands of PCV2 in situ that can be useful for studies of replication and in situ detection of PCV2 as well as of DNA viruses in general.

The DNA vaccine vector pcDNA3 induces IFN-α production in pigs

Abstract The cytokine inducing capacity of the vaccine vector pcDNA3, a methylated form of the plasmid, and pcDNA3 encoding porcine interleukin (IL)-6 or granulocyte/macrophage colony-stimulating factor (GM-CSF) was studied in pigs, using a model with tissue chambers implanted subcutaneously. The production of interferon (IFN)-α, IFN-γ, IL-6 and GM-CSF was studied at local (tissue chamber fluid (TCF)) and systemic (serum) levels during 3 days post-injection. All forms of the plasmid, except the methylated, induced a transient local production of IFN-α but no plasmid-induced production of IFN-γ, GM-CSF or IL-6 could be detected after injection of the plasmids. The IFN-α response increased markedly at repeated injections of pcDNA3. This IFN-α inducing capacity of the plasmid is likely to affect immune responses at DNA vaccination of pigs.

Tissue chambers — a useful model for in vivo studies of cytokine production in the pig

Abstract An in vivo tissue chamber model was developed to enable studies of local cytokine production and cellular events during inflammatory and immune reactions in the pig. Tissue chambers made of sialistic rubber tubing were surgically implanted in the subcutaneous tissue and samples of tissue chamber fluid (TCF) and inflammatory cells were collected by aspiration with a syringe. To evaluate the model for local cytokine production, two cytokine inducers, polyribinosinic-polyribocytidylic acid (poly I:C) and fixed Aujeszkys disease virus infected PK15 cells (ADV-PK15), were injected into the tissue chambers and samples of TCF were collected 0, 4, 8, 12, 24 and 48 h post injection. Poly I:C injections induced local production of interferon-α (IFN-α) as well as tumor necrosis factor (TNF) in the TCF but kinetic differences in the production of the cytokines were noted. Poly I:C also induced an increase in cell numbers in the TCF, mainly due to increased neutrophil numbers. Injections of ADV-PK15 induced local IFN-α production in the TCF as long as the pigs were serologically negative to ADV. Immunofluorescence and in situ hybridization techniques could be applied for characterization of TCF cells. Moreover, cells recovered from the tissue chambers were viable and could be used in functional in vitro tests. Taken together, this tissue chamber model could prove very useful in in vivo studies of inflammatory/immune responses and cytokine production in the pig.

Bovine leukemia virus: early reflections in blood after an experimental infection of calves.

In order to study early alterations in the blood following infection with bovine leukemia virus (BLV) in the natural host, 15 calves were inoculated with blood from a BLV-positive donor cow. The humoral immunological response was followed by ELISA for 2 months. Seroconversion to BLV was demonstrated at 4-5 weeks post-infection. Total and differential leukocyte counts were performed. Acute lymphocytosis was observed at the time of seroconversion in the majority of the experimental calves. By the aid of monoclonal antibodies (mAbs), the proportion as well as the total number of lymphoid cells were studied in four of the calves, applying analytical flow cytometry. At the time of seroconversion the percentage of B-cells increased from 19.1 +/- 7.5% to 37.9 +/- 15.8%, and the T-cells (CD2+) decreased from 36.7 +/- 7.3% to 22.7 +/- 6.0%, the latter being attributable to decreases in the percentage of CD4+ as well as CD8+ T-cells for the infected calves together. Subsequently, altered B/T ratios were observed. In one of the calves an increase in the absolute number of CD5+ cells coincided with an increase in total B-cells. The early phenotypic alterations in lymphocyte subsets, before and after seroconversion to BLV, were comparable to those of non-lymphocytotic and persistent lymphocytotic cattle, respectively. Sera from 15 calves were tested for the presence of interferon (IFN), as measured by antiviral activity. BLV does not appear to induce the production of IFN.

Expression of reference genes and T helper 17 associated cytokine genes in the equine intestinal tract.

There is accumulating evidence for the involvement of pro-inflammatory cytokines associated with a T helper 17 response in intestinal disorders such as inflammatory bowel disease (IBD) in humans. The involvement of interleukin (IL)-17 or IL-23 in equine IBD has not been studied and most gene expression studies in the equine intestine have been limited to the use of a single non-validated reference gene. In this study, expression of the reference gene candidates β2 microglobulin (β2M), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), histone H2A type 1, hypoxanthine-guanine phosphoribosyltransferase (HPRT), 60S ribosomal protein L32 (RPL32), succinate dehydrogenase complex subunit A (SDHA) and transferrin receptor 1 protein coding (TFRC)in the equine intestine was evaluated by quantitative PCR. Three to four reference genes were adequate for normalisation of gene expression in the healthy duodenum, mid-jejunum, colon and rectum, although each segment required a unique combination of reference genes. No combination of the evaluated genes was optimal for the caecum and ileum. Another combination of reference genes (GAPDH, HPRT, RPL32 and SDHA) was optimal for normalisation of rectal samples from healthy and IBD-affected horses, indicating that reference genes should be re-evaluated if material from diseased specimens is analysed. Basal expression of IL-12p40, IL-17A and IL-23p19 was detected in each segment, which will enable gene expression studies of these cytokines by relative quantification.