Mark A. Winters

A randomized study of antiretroviral management based on plasma genotypic antiretroviral resistance testing in patients failing therapy

ObjectiveTo determine the short-term effects of using genotypic antiretroviral resistance testing (GART) with expert advice in the management of patients failing on a protease inhibitor and two nucleoside reverse transcriptase inhibitors. DesignProspective randomized controlled trial. SettingMulticenter community-based clinical trials network. PatientsOne-hundred and fifty-three HIV-infected adults with a threefold or greater rise in plasma HIV-1 RNA on at least 16 weeks of combination antiretroviral therapy. InterventionsRandomization was either to a GART group, where genotype interpretation and suggested regimens were provided to clinicians, or to a no-GART group, where treatment choices were made without such input. Main outcomes measuresPlasma HIV-1 RNA levels and CD4 cell counts were measured at 4, 8, and 12 weeks following randomization. The primary endpoint was change in HIV-1 RNA levels from baseline to the average of the 4 and 8 week levels. ResultsThe average baseline CD4 cell count was 230 × 106 cells/l and the median HIV-1 RNA was 28 085 copies/ml. At entry, 82 patients were failing on regimens containing indinavir, 51 on nelfinavir, 11 on ritonavir, and nine on saquinavir. HIV-1 RNA, averaged at 4 and 8 weeks, decreased by 1.19 log10 for the 78 GART patients and -0.61 log10 for the 75 no-GART patients (treatment difference: −0.53 log, 95% confidence interval, −0.77 to −0.29;P  = 0.00001). Overall, the best virologic responses occurred in patients who received three or more drugs to which their HIV-1 appeared to be susceptible. ConclusionIn patients failing triple drug therapy, GART with expert advice was superior to no-GART as measured by short-term viral load responses.

The Effect of High-Dose Saquinavir on Viral Load and CD4+ T-Cell Counts in HIV-Infected Patients

Human immunodeficiency virus (HIV) protease inhibitors are a new class of antiretroviral agents that target a different point in the HIV life cycle than do zidovudine and other dideoxy nucleoside or non-nucleoside reverse transcriptase inhibitors. The HIV genes gag and gag-pol are translated into large polyproteins that contain the individual structural and functional HIV proteins. The HIV protease is required to cleave these polyproteins to produce infectious virus. Studies showing that the inhibition of the HIV protease resulted in the production of immature and noninfectious virus [1-3] led to the development of HIV protease inhibitors. Saquinavir is a transitional state analogue peptidomimetic inhibitor of the HIV protease [4, 5]. In vitro studies have shown that it is a potent inhibitor of HIV replication [5, 6]; preliminary clinical trials [7] have shown that it elevates CD4+ T-cell counts and suppresses viral load as measured by plasma HIV RNA levels. Pharmacokinetics studies have shown that it has low bioavailability [8]. Reported side effects are of mild to moderate intensity and include abdominal discomfort, vomiting, diarrhea, headache, and dizziness. Abnormal laboratory results have included occasional elevations in serum aminotransferase and creatinine phosphokinase levels [7]. As have patients receiving other antiretroviral agents, patients receiving protease inhibitors have had mutations in the HIV genome, and in vitro studies have suggested that phenotypic resistance results from these changes [9-13]. Mutations at codons 48 (GV) and 90 (LM) of the HIV protease gene appear to develop in the presence of saquinavir and lead to phenotypic resistance to the drug [14-16]. Mutations at other codons, such as codon 54, have also occasionally been implicated in conferring resistance to saquinavir, and increased resistance has been found when more than one mutation is present [15-17]. Resistance mutations to other protease inhibitors currently being studied in clinical trials have also been well documented [18-20]. Cross-resistance between protease inhibitors has been shown to occur in vitro [9, 20, 21]. Although some evidence suggests this may be less of a problem with saquinavir than with other protease inhibitors [9, 22], other reports have shown that saquinavir is also involved in cross-resistance [20, 21]. The clinical relevance of these mutations is not yet completely understood. Saquinavir has been licensed for use in HIV-infected patients at a dose of 1800 mg/d. Studies of saquinavir at this dose showed that it produced a median reduction of 80% in plasma HIV RNA levels and a median elevation of 50 cells/mm3 in CD4+ T-cell count, although the duration of the effect was short and values had returned nearly to baseline by week 16 [7]. Preliminary results comparing combination therapy with zidovudine plus zalcitabine, zidovudine plus saquinavir, and all three drugs together showed that the triple combination produced a more favorable response without increased toxicity [23]. Because saquinavir at a dose of 1800 mg/d had been shown to favorably influence viral load and CD4+ T-cell counts without producing severe toxicity, and because the drug has low bioavailability, it was postulated that higher doses might produce a greater antiviral effect without significantly increasing toxicity. We studied saquinavir at twice and four times the currently licensed dose to determine the efficacy, safety, and pharmacokinetics of saquinavir and to identify the optimal dose of saquinavir for future study both as monotherapy and in combination with other antiretroviral agents. Methods Persons who were positive for HIV type 1, were 18 years of age or older, had CD4+ T-cell counts of 200 to 500 cells/mm3, and had no active opportunistic infections were eligible for the study. Saquinavir was dispensed to patients as 200-mg capsules twice weekly and then once monthly. Compliance was monitored by patient report and capsule count. Toxicity Patients were initially monitored three times a week, then twice a week, and then once a month for any reported symptoms or signs of drug toxicity. Frequent laboratory testing was also done; tests included measurement of complete blood and platelet counts; serum chemistry tests; liver function tests; tests for amylase, triglyceride, and creatinine phosphokinase levels; and urinalysis. In patients with grade 3 toxicity, drug therapy was briefly discontinued and then restarted. Virology Quantitative peripheral blood mononuclear cell cultures were done by incubating serial fivefold dilutions of patient peripheral blood mononuclear cells (starting with 1 106 cells) in duplicate with 1 106 phytohemagglutin-stimulated normal peripheral blood mononuclear cells for 14 days. This was done according to the AIDS (acquired immunodeficiency syndrome) Clinical Trials Group consensus protocol for quantitative microcultures [24]. Measurements of p24 antigen levels were made for each dilution by using a commercially available p24 antigen kit (Abbott Diagnostics, Chicago, Illinois), and the results were expressed as infectious units per million peripheral blood mononuclear cells. Plasma HIV RNA levels were measured by using a previously described reverse transcriptase polymerase chain reaction (PCR) technique [25] that has been validated in a multicenter study [26]. Duplicate plasma samples were subjected to ultracentrifugation, and the pellets were extracted by using phenolchloroform. The resulting RNA pellets were reverse transcribed along with a standard curve of known RNA copy number and then amplified by PCR with gag-specific primers. The amount of product in each reaction was measured using a nonisotopic enzyme hybridization assay and was expressed as optical density. The standard curve was generated by plotting the number of RNA copies against the optical density, and the Equation describing the curve was used to calculate the numbers of RNA copies in the patient samples. These numbers were expressed as log RNA copies/mL of plasma. Serum p24 antigen levels were measured by Immunodiagnostic Laboratories (Hayward, California) using an enzyme-linked immunoassay system with an immune-complex disassociation step. Peripheral blood mononuclear cell viral DNA levels were measured using a previously described quantitative PCR technique [27]. Aliquots of 1 10 (6) peripheral blood mononuclear cell pellets were lysed with proteinase K, and 250 000 cell equivalents were amplified in duplicate with a standard curve of known DNA copy number. The amount of product in each reaction was measured using a nonisotopic enzyme hybridization assay and expressed as optical density. The standard curve was generated by plotting the number of DNA copies against optical density, and the Equation describingthe curve was used to calculate the number of DNA copies in the patient samples. These numbers were corrected for percentages of cells that are CD4 cells and expressed as log DNA copies per million CD4 cells. Immunology CD4+ T-cell counts were measured by the AIDS Clinical Trials Group-qualified flow cytometry laboratory at Stanford University Hospital. A screening measurement and two baseline measurements (obtained 2 weeks apart) were done. The average of these three results was used as the baseline value. CD4+ T-cell counts were obtained monthly at the same time that blood was drawn for virologic tests. Mutations The presence of mutations at codon 48 (GV) and 90 (LM) in the plasma of patients was determined by using a selective PCR method similar to that used for the reverse transcriptase gene [28, 29]. Cryopreserved plasma was extracted as previously described [25] and was reverse transcribed using primer TGGAGTATTGTATGGATTTTCAG (Pro1). The complementary DNA was then amplified by using PCR under standard conditions with primer CAGAGCCAACAGCCCCACCA (Pro2). Five L of the 582-base pair first-round PCR product was then amplified with primers specific for the wild-type and mutant sequences at each codon. For codon 48, primers CTTCCTTTTCCATCTCTGTA (IR48) and TGGAAACCAAAAATGACAGG (48WT) were used to determine whether a wild-type sequence was present, and IR48 and TGGAAACCAAAAATGACAGT (48MU) were used to determine whether a mutant sequence was present. For codon 90, primers GAAGCTCTATTAGATACAGG (IR90) and GTGCAACCAATCTGAGCCAA (90WT) were used to determine whether a wild-type sequence was present, and IR90 and GTGCAACCAATCTGAGCCAT (90MU) were used to determine whether a mutant sequence was present. Twenty L of the PCR product from each of the second set of PCR reactions was analyzed for genotype on 3.0% agarose gel with ethidium bromide staining. The PCR products were determined to have a mutant or wild-type sequence according to the method described by Boucher and colleagues [30, 31] and Larder and associates [28]. A sample was considered to contain the codon 48 wild-type sequence if amplification with primers IR48 and 48WT resulted in a 309-base pair product. A sample was considered to contain the codon 90 wild-type sequence if amplification with primers IR90 and 90WT resulted in a 228-base pair product. A sample was considered to contain the codon 90 mutant sequence if amplification with primers IR90 and 90MU resulted in a 228-base pair product. Samples showing bands in both the wild-type and mutant reactions were re-evaluated using 5 L of a 1:20 and 1:400 dilution of the first-round PCR product in a second-round reaction. Samples showing only a wild-type or mutant product in the dilution reactions were scored as wild-type or mutant, respectively. Samples showing both the wild-type and mutant products in the dilution reactions were considered to be mixtures. Samples in which a mixture was detected were reported as mutant for the purposes of the analysis. Patients showing a mutation at either codon 48 or codon 90 at week 24 were assayed at earlier time points to determine the timing of the appearance of the mutation. The selectiv

Phase 2 gene therapy trial of an anti-HIV ribozyme in autologous CD34+ cells

Gene transfer has potential as a once-only treatment that reduces viral load, preserves the immune system and avoids lifetime highly active antiretroviral therapy. This study, which is to our knowledge the first randomized, double-blind, placebo-controlled, phase 2 cell-delivered gene transfer clinical trial, was conducted in 74 HIV-1-infected adults who received a tat-vpr-specific anti-HIV ribozyme (OZ1) or placebo delivered in autologous CD34+ hematopoietic progenitor cells. There were no OZ1-related adverse events. There was no statistically significant difference in viral load between the OZ1 and placebo group at the primary end point (average at weeks 47 and 48), but time-weighted areas under the curve from weeks 40-48 and 40-100 were significantly lower in the OZ1 group. Throughout the 100 weeks, CD4+ lymphocyte counts were higher in the OZ1 group. This study indicates that cell-delivered gene transfer is safe and biologically active in individuals with HIV and can be developed as a conventional therapeutic product.

Multiple Concurrent Reverse Transcriptase and Protease Mutations and Multidrug Resistance of HIV-1 Isolates from Heavily Treated Patients

Recent studies have shown that HIV-1 replication can be dramatically curtailed, if not completely arrested, with potent combinations of antiretroviral drugs [1-3]. The success of these combinations is thought to be partly due to the fact that many mutations must occur before HIV-1 becomes resistant to every drug in a given combination [4-6]. The benefits of combination therapy, however, are diminished in patients who have previously received antiretroviral therapy and who may have HIV-1 strains resistant to one or more of the drugs in a combination regimen [1, 7, 8]. To identify HIV-1 isolates resistant to multiple antiretroviral agents, we examined isolates from four heavily treated patients with HIV-1 infection who had started receiving antiretroviral therapy before potent three-drug combinations were available and had not achieved plasma HIV-1 RNA suppression despite treatment with several combination regimens. We reasoned that because these patients had ongoing HIV-1 replication, they were at risk for developing HIV-1 strains resistant to each of the drugs they had received. Methods Patients We obtained HIV-1 isolates from four consecutive patients who had received prolonged antiretroviral therapy and had not achieved plasma HIV-1 RNA suppression despite therapy with several drug combinations. Between August 1996 and February 1997, three viral samples each were obtained from patients 1,2, and 3. Patient 4 died before a follow-up sample was obtained for repeated sequencing and viral culture. Virus Isolation Peripheral blood mononuclear cells from the patients were co-cultured with phytohemagglutinin-stimulated peripheral blood mononuclear cells from HIV-seronegative blood donors. When the HIV-1 p24 antigen concentration in the culture exceeded 20 ng/mL, aliquots of supernatant were harvested for drug susceptibility testing. Wild-type control HIV-1 isolates (NL43 and H112) were obtained from the National Institutes of Health AIDS Research and Reference Reagent Program. Reverse Transcriptase and Protease Sequencing We extracted HIV-1 RNA from plasma and from aliquots of cultured virus stock [9]. Nested polymerase chain reaction was then used to generate a 1.3-kb fragment encompassing HIV-1 protease and the first 250 residues of reverse transcriptase. Direct dideoxyterminator sequencing of the polymerase chain reaction product was done in both directions by using overlapping internal primers. Sequences were compared with the HIV-1 subtype B consensus sequence [10] and submitted to GenBank (AF047280-AF047321) [11]. Drug Susceptibility Testing Susceptibility tests were done on one isolate each from patients 1 (August 1996), 2 (November 1996), and 3 (January 1997). Patient and wild-type control isolates were tested in triplicate with zidovudine (Glaxo Wellcome, Research Triangle Park, North Carolina), didanosine (Bristol-Myers Squibb, Wallingford, Connecticut), zalcitabine (Roche Laboratories, Nutley, New Jersey), stavudine (Bristol-Myers Squibb), saquinavir (Roche Laboratories), indinavir (Merck & Co., Whitehouse Station, New Jersey), and nelfinavir (Agouron Pharmaceuticals, La Jolla, California) and in duplicate with lamivudine (Glaxo Wellcome) and nevirapine (Boehringer-Ingleheim, Ridgefield, Connecticut). A 50% tissue culture infectious dose of virus stock of 30 to 100 was used to infect 1 000 000 peripheral blood mononuclear cells from HIV-seronegative blood donors in the presence and absence of increasing drug concentrations [12]. After 4 days, HIV-1 p24 antigen production was measured in culture supernatant and the drug concentrations required to inhibit p24 antigen production by 90% (IC90) compared with drug-free controls were calculated. Drug concentrations were 0.0005, 0.005, 0.05, 0.5, and 5 mol/L for zidovudine; 0.6, 1.2, 2.5, 5, and 10 mol/L for didanosine; 0.06, 0.12, 0.25, 0.5, and 1.0 mol/L for stavudine and zalcitabine; and 0.016, 0.08, 0.4, 2, and 10 mol/L for lamivudine, nevirapine, saquinavir, indinavir, and nelfinavir. Biological Cloning Serial fourfold dilutions of the initial virus stock of each isolate were co-cultured with 1 000 000 peripheral blood mononuclear cells from HIV-seronegative blood donors and monitored for HIV-1 p24 antigen production. Cultures in which fewer than one third of wells were positive were considered to represent infection with a single replication-competent virus. Statistical Analysis Statistical descriptions of groups of IC90 were done using log-transformed IC90. Nucleotide distances between all pairs of sequences were calculated to exclude the possibility of laboratory contamination or transmission between patients [13]. Results Antiretroviral Treatment History and Clinical Course By August 1996, each patient had received drug treatment for 4 to 9 years (Figure 1). Each patient began receiving zidovudine and then added or substituted other drugs as they became available. Eventually, each patient received at least four of the five available nucleoside analogue reverse transcriptase inhibitors and two or three of the four available protease inhibitors. No patient received a non-nucleoside reverse transcriptase inhibitor or nelfinavir, the fourth approved protease inhibitor. Figure 1. Serial plasma HIV-1 RNA levels and CD4+ lymphocyte counts of four patients with multidrug-resistant HIV-1 isolates. Patient 1 had localized cutaneous Kaposi sarcoma diagnosed in 1992. Patient 4 had several opportunistic infections between 1994 and 1996 and died in December 1996. Patients 2 and 3 had no HIV-related complications. Isolates of HIV-1 from patient 3 were syncytium-inducing; isolates from patients 1 and 2 were not syncytium-inducing. Despite treatment with several drug combinations, only two patients had reductions in plasma HIV-1 RNA levels. These levels were not reduced below the limit of detection in any patient. Drug Susceptibility Isolates from three patients were available for susceptibility testing. Each isolate had high-level resistance to zidovudine (90-fold to 470-fold) and lamivudine (>400-fold) and low-level resistance to didanosine (3-fold), zalcitabine (3-fold to 4-fold), and stavudine (3-fold to 5-fold) (Table 1 and Table 2). Each isolate was also resistant to the protease inhibitors saquinavir (90-fold to 200-fold), indinavir (50-fold to 100-fold), and nelfinavir (30-fold to 50-fold) (Table 1 and Table 2). Ritonavir was not tested because indinavir-resistant isolates are usually also resistant to ritonavir [5, 6, 14]. Each isolate was susceptible to the non-nucleoside reverse transcriptase inhibitor nevirapine. Table 1. Reverse Transcriptase Mutations, Protease Mutations, and Drug Susceptibility of Multidrug-Resistant HIV-1 Isolates from Four Heavily Treated Patients* Table 2. Table 1 Continued Protease and Reverse Transcriptase Sequences The four patients had isolates sharing seven protease mutations associated with drug resistance (L10I, G48V, I54V/T, L63P/H/Q, A71V/L, V77I, and V82A) [5, 6, 14]. Three patients had isolates sharing eight reverse transcriptase mutations, including zidovudine-resistance mutations (M41L, D67N, L210W, and T215Y) and the lamivudine-resistance mutation (M184V) [4, 14]. Other shared mutations were K43E/N, E44D/A, and V118I [4, 14]. In addition to the shared mutations, the protease-inhibitor resistance mutations M46I and L90M and the reverse transcriptase mutation L74I were present in the isolate from patient 4. The isolate from patient 2 had the zalcitabine-resistance mutation T69D [14]. Mutations V60I, K102Q, Q207E, H208Y, and K219N were each present in isolates from two patients. Co-Linearity and Stability of Reverse Transcriptase and Protease Mutations To determine whether the reverse transcriptase and protease mutations occurred in the same HIV-1 genomes, we sequenced the reverse transcriptase and protease genes of two biological clones from patients 1, 2, and 3 and found that all six clones had the reverse transcriptase and protease mutations shown in the Table 1 and (Table 2). Patients 1, 2, and 3 each had three different isolates sequenced between August 1996 and January 1997. During this period, there was little intrapatient sequence divergence in either the reverse transcriptase or the protease genes (0.8% and 0.6%, respectively). With one exception (the August 1996 isolate from patient 3 lacked M184V), each isolate had the mutations shown in the Table 1 and (Table 2). Interpatient Sequence Divergence Isolates from the four patients had a mean nucleotide sequence divergence of 6.4% for the protease gene and 5.6% for the reverse transcriptase gene, suggesting that the shared mutations did not result from laboratory contamination or transmission of a single HIV-1 strain. Previous HIV-1 Isolates A June 1990 isolate from patient 1 had the zidovudine-resistance mutations M41L and T215Y and was highly resistant to zidovudine. However, it was susceptible to the other reverse transcriptase inhibitors and to the protease inhibitors. A March 1995 isolate from patient 1, obtained after 6 months of saquinavir therapy, had the protease mutations G48V, L63P, A71V, and T74A and had an approximately 10-fold decreased susceptibility to both saquinavir and nelfinavir but no reduced susceptibility to indinavir. Discussion This report shows that HIV-1 has the potential to develop resistance to most available antiretroviral drugs. The patients described had HIV-1 isolates with high-level resistance to zidovudine, lamivudine, indinavir, saquinavir, and nelfinavir and lower-level resistance to didanosine, zalcitabine, and stavudine. No patient had received a non-nucleoside reverse transcriptase inhibitor, and all isolates were susceptible to drugs of this class. Additional preliminary studies have shown that these isolates are at least partly cross-resistant to the experimental nucleoside analogue reverse transcriptase inhibitor 1592U89 (Glaxo Wellcome) and the protease inhibitor 141W (Glaxo Wellcome) but are susceptible to the experimental

A transitional endogenous lentivirus from the genome of a basal primate and implications for lentivirus evolution

Lentiviruses chronically infect a broad range of mammalian species and have been transmitted from primates to humans, giving rise to multiple outbreaks of HIV infection over the past century. Although the circumstances surrounding these recent zoonoses are becoming clearer, the nature and timescale of interaction between lentiviruses and primates remains unknown. Here, we report the discovery of an endogenous lentivirus in the genome of the gray mouse lemur (Microcebus murinus), a strepsirrhine primate from Madagascar, demonstrating that lentiviruses are capable of invading the primate germ line. Phylogenetic analysis places gray mouse lemur prosimian immunodeficiency virus (pSIVgml) basal to all known primate lentiviruses and, consistent with this, its genomic organization is intermediate between the nonprimate lentiviruses and their more derived primate counterparts. Thus, pSIVgml represents the first unambiguous example of a viral transitional form, revealing the acquisition and loss of genomic features during lentiviral evolution. Furthermore, because terrestrial mammal populations in Madagascar and Africa are likely to have been isolated from one another for at least 14 million years, the presence of pSIVgml in the gray mouse lemur genome indicates that lentiviruses must have been infecting primates for at least this period of time, or have been transmitted between Malagasy and African primate populations by a vector species capable of traversing the Mozambique channel. The discovery of pSIVgml illustrates the utility of endogenous sequences for the study of contemporary retroviruses and indicates that primate lentiviruses may be considerably older and more broadly distributed than previously thought.

Ultrasensitive detection of rare mutations using next-generation targeted resequencing

With next-generation DNA sequencing technologies, one can interrogate a specific genomic region of interest at very high depth of coverage and identify less prevalent, rare mutations in heterogeneous clinical samples. However, the mutation detection levels are limited by the error rate of the sequencing technology as well as by the availability of variant-calling algorithms with high statistical power and low false positive rates. We demonstrate that we can robustly detect mutations at 0.1% fractional representation. This represents accurate detection of one mutant per every 1000 wild-type alleles. To achieve this sensitive level of mutation detection, we integrate a high accuracy indexing strategy and reference replication for estimating sequencing error variance. We employ a statistical model to estimate the error rate at each position of the reference and to quantify the fraction of variant base in the sample. Our method is highly specific (99%) and sensitive (100%) when applied to a known 0.1% sample fraction admixture of two synthetic DNA samples to validate our method. As a clinical application of this method, we analyzed nine clinical samples of H1N1 influenza A and detected an oseltamivir (antiviral therapy) resistance mutation in the H1N1 neuraminidase gene at a sample fraction of 0.18%.

Inter- and Intragenic Variations Complicate the Molecular Epidemiology of Human Cytomegalovirus

Human cytomegalovirus isolates were analyzed, both by restriction fragment-length polymorphism typing and by sequencing for intra- and intergenic variability at 9 sites on the genome, to determine whether genetic variation influenced disease outcome and whether linkage among genes could be identified. Variation at the UL55 (glycoprotein B [gB]), UL74 (gO), UL75 (gH), UL115 (gL), US9, and US28 gene open-reading frames was studied in relationship to outcome of cytomegalovirus disease. Major findings were that (1) on the basis of analysis of only 9 genomic sites, it is apparent that an almost infinite number of genetic combinations are theoretically possible; (2) genetic linkages are rare; (3) intragenic variability may be a complicating factor in molecular epidemiologic studies; and (4) analysis of only a single gene from a clinical isolate may not reveal the presence of either intragenic variants or mixtures of genotypes.

The Genes Encoding the gCIII Complex of Human Cytomegalovirus Exist in Highly Diverse Combinations in Clinical Isolates

ABSTRACT The UL74 (glycoprotein O [gO])-UL75 (gH)-UL115 (gL) complex of human cytomegalovirus (CMV), known as the gCIII complex, is likely to play an important role in the life cycle of the virus. The gH and gL proteins have been associated with biological activities, such as the induction of virus-neutralizing antibody, cell-virus fusion, and cell-to-cell spread of the virus. The sequences of the two gH gene variants, readily recognizable by restriction endonuclease polymorphism, are well conserved among clinical isolates, but nothing is known about the sequence variability of the gL and gO genes. Sequencing of the full-length gL and gO genes was performed with 22 to 39 clinical isolates, as well as with laboratory strains AD169, Towne, and Toledo, to determine phylogenetically based variants of the genes. The sequence information provided the basis for identifying gL and gO variants by restriction endonuclease polymorphism. The predicted gL amino acid sequences varied less than 2% among the isolates, but the variability of gO among the isolates approached 45%. The variants of the genes coding for gCIII in laboratory strains Towne, AD169, and Toledo were different from those in most clinical isolates. When clinical isolates from different patient populations with various degrees of symptomatic CMV disease were surveyed, the gO1 variant occurred almost exclusively with the gH1 variant. The gL2 variant occurred with a significantly lower frequency in the gH1 variant group. There were no configurations of the gCIII complex that were specifically associated with symptomatic CMV disease or human immunodeficiency virus serologic status. The potential for the gCIII complex to exist in diverse genetic combinations in clinical isolates points to a new aspect that must be considered in studies of the significance of CMV strain variability.

Didanosine resistance in HIV-infected patients switched from zidovudine to didanosine monotherapy

Clinical benefit from zidovudine therapy in patients infected with human immunodeficiency virus (HIV) is short-lived. Patients treated with zidovudine ultimately progress to the acquired immunodeficiency syndrome (AIDS), and strains of HIV resistant to zidovudine eventually develop while patients are receiving the drug [1]. Kahn and colleagues [2] reported that patients infected with HIV who have relatively advanced disease and at least 16 weeks of previous zidovudine therapy may have clinical benefit if switched to didanosine monotherapy instead of remaining on zidovudine. The reason patients benefit from switching from zidovudine to didanosine is not fully understood, but one possibility is that didanosine suppresses zidovudine-resistant HIV. Increasing evidence exists of a correlation between zidovudine-resistant HIV and disease progression in patients treated with zidovudine monotherapy [3-8]. It has been shown that HIV can also develop resistance to didanosine [9-11]. As with the resistance of HIV to zidovudine, the decrease in susceptibility of HIV to didanosine has been shown to be caused by specific mutations in the HIV reverse-transcriptase gene. St. Clair and colleagues [9] identified the first mutation in the reverse-transcriptase gene to confer resistance to didanosine, a mutation at codon 74 that results in an amino acid change from leucine to valine. The codon 74 mutation in an HIV construct can induce an eightfold decrease in susceptibility to didanosine [9]. Although other mutations have been reported to confer didanosine resistance [12], most data to date suggest that the codon 74 mutation is the primary mutation responsible for didanosine resistance in patients receiving didanosine monotherapy [9, 13-16]. Researchers have postulated [17, 18] that genotypic assays that can detect HIV reverse-transcriptase mutations may be used in place of drug susceptibility testing when a proven association exists between a specific mutation and drug resistance. Previously we reported [5] that in patients who are receiving zidovudine monotherapy, the development of a serum HIV RNA mutation at codon 215 (which confers a 16-fold decrease in susceptibility to zidovudine [18]) was strongly associated with and predictive of decreases in CD4+ T cells in these patients. In the current study, we obtained serum HIV RNA from patients who were switched from zidovudine to didanosine therapy, and we examined the relation of the codon 74 mutation in patient serum HIV RNA to changes in CD4+ T-cell levels and HIV virus burden. The development of the codon 74 mutation in relation to the genotype at codon 215 was also examined because researchers have shown that the combination of codon 215 and codon 74 mutations can restore HIV susceptibility to zidovudine [9] and that the preexistence of zidovudine resistance mutations may actually augment didanosine resistance [9, 13, 14]. Methods Patients Sixty-four patients infected with HIV were enrolled in three protocols at Stanford University Medical Center: 1) Eight patients were enrolled in Stanford University/San Mateo County Didanosine Protocol [19], an open-labeled study involving patients who had received zidovudine [Retrovir; Burroughs Wellcome, Research Triangle Park, North Carolina] for more than 16 months who were switched to didanosine; 2) 33 patients were enrolled in AIDS Clinical Trial Group Protocols [2] 116b/117 who had tolerated zidovudine for at least 16 weeks and were then switched to didanosine; and 3) 23 patients were enrolled in AIDS Clinical Trial Group Protocol 118 who were intolerant to zidovudine and who had been switched to didanosine. The baseline CD4+ T-cell counts of the patients ranged from 6 to 400 CD4+ T cells/mm3 (median, 105 CD4+ cells/mm3), and patients had either AIDS, AIDS-related complex, or were asymptomatic. No patient had an active opportunistic infection at the time of enrollment in the study, and patients received Pneumocystis carinii prophylaxis as defined by each protocol and were allowed to continue suppressive therapy for previously diagnosed opportunistic infections [2, 19]. Patients received didanosine (Videx; Bristol Laboratories, Princeton, New Jersey) monotherapy at one of three possible dosages: 200 mg/d (6 patients), 500 mg/d (31 patients), or 750 mg/d (27 patients). Serial serum samples were saved at week 0, 2, 8, 12, 16, 24, 32, 40, and 48; at these same time points, CD4+ T-cell determinations were done. All patients were followed until the close of study or until death. Reverse-Transcriptase Gene Mutational Analysis Cryopreserved (70C) serum was thawed and 200 L was ultracentrifuged at 125 000 g for 10 minutes. The resulting pellet was dissolved in 400 L of 5-M guanidium thiocyanate. Serum HIV RNA was then extracted as previously described [20-22]. Extracted viral RNA was then reverse-transcribed to cDNA using 500 ng of primer 35-NE1 [17] and 5 units of murine leukemia virus reverse transcriptase (Bethesda Research Laboratories, Gaithersburg, Maryland) with reaction conditions and controls as previously described [5, 16]. The cDNA was amplified by PCR using 250 ng of primer 35-A [17] with the reaction conditions described by Larder and Boucher and colleagues [17, 18]. For selective PCR, 5 L of the 805-basepair product from the first PCR was used in the second series of reactions. Primers 3W (wild type), 3M (mutant), and B [17, 18] were used to determine the sequence at codon 215; primers X2 and 74WT (wild type) and 74M (mutant) [9, 16] were used to determine the sequence at codon 74. Master mix, negative, wild-type, and mutant sequenced controls were amplified in each sample run. Non-reverse-transcribed control samples subjected to the PCR procedure yielded negative results, and patient RNA samples treated with deoxyribonuclease yielded identical results to patient RNA samples using our extraction procedure, validating that the reverse-transcriptase PCR product was the result of HIV RNA and not DNA. The purity of the extracted RNA using the guanidium thiocyanate-phenol-chloroform extraction technique has been previously reported by Chomczynski and Sacchi [22]. Fifteen HIV isolates that had been tested in our laboratory by nested PCR for the codon 74 and 215 mutations were also sequenced and confirmed the presence or absence of these mutations. Products from PCR were analyzed on a 3% agarose gel with ethidium bromide staining. All samples had been blinded by a code number from the start and thus the evaluator who scored the PCR product had no knowledge of sample origin (that is, the corresponding patient). Samples yielding a product with only the wild-type primers were considered wild type. Samples that yielded product with only the mutant primers were considered mutant. If a sample yielded product with wild-type and mutant primers, the second PCR step was repeated with serial dilutions of the first round PCR (at dilutions of 1:20, 1:400, and 1:8000); if a mixture of wild type and mutant was still present after serial dilutions, the sample was considered a mixture of wild-type and mutant sequences at the codon of interest. Samples with a mixture of wild-type and mutant sequences at the codon were included in the mutant group in our statistical analysis. Serum HIV RNA Preparation for Virus Burden Duplicate serum samples were ultracentrifuged, and the pellet was purified by phenol-chloroform extraction and alcohol precipitation, as previously described for plasma [20]. Polymerase chain reaction quantification of viral RNA was done using reverse-transcriptase PCR, and the PCR product was detected using a nonisotopic enzyme hybridization assay, as previously described [20, 21]. Results were then expressed as HIV RNA copies per milliliter of serum. HIV Biological Phenotype For the 25 patients for whom cryopreserved peripheral blood mononuclear cells were available, viral stocks were created from these mononuclear cells by cocultivation with peripheral blood mononuclear cells from patients who were seronegative for HIV. Viral stock supernatant (the tissue culture infective dose50 was about 2000), 200 L, was cultured with 8 mL of MT-2 cells (0.5 106 cells/mL) in duplicate. Cultures were maintained for 3 weeks and were examined for syncytia twice a week, as described by Koot and colleagues [23]. CD4+ Cell Counts CD4+ cell counts were done at weeks 0, 2, 4, 8, 12, 16, 24, 32, 40, and 48 by the Stanford University Blood Bank (a certified member of the National Institute of Allergy and Infectious Diseases, Division of AIDS, the CD4+ T-cell quality assurance program for the AIDS Clinical Trial Group). Statistical Analysis A two-sided t-test was used to compare changes in virus burden between patient groups. A standard one-sample, two-sided Wilcoxon test was used to compare differences in the change of slopes of CD4+ T cells (slopes of CD4+ cells before the mutation compared with slopes of CD4+ cells after the mutation) for patients developing a mutation at codon 74. The slope difference test analysis pertained to the slope difference statistic, defined to be the difference in fitted slope of the CD4+ counts after compared with before the mutation at codon 74. Thirty-four of 38 patients in the mutation group had sufficient data to allow computation of the slope difference statistic. We compared the slope difference statistic values for the 34 mutants with the corresponding values from the wild-type group in order to see if they were more negative in the mutant group. This is not possible directly because the wild-type group by definition has no mutation time from which to define before and after. Instead, artificial slope difference values were constructed as follows: 1) a random participant was chosen from the 25 in the wild-type group; 2) a random mutation time was chosen from the 38 such times in the mutation group; and 3) if the mutation time was less than the last observation time for the randomly selected participant, then the wild-typ

Crystal Structures of a Multidrug-Resistant Human Immunodeficiency Virus Type 1 Protease Reveal an Expanded Active-Site Cavity

ABSTRACT The goal of this study was to use X-ray crystallography to investigate the structural basis of resistance to human immunodeficiency virus type 1 (HIV-1) protease inhibitors. We overexpressed, purified, and crystallized a multidrug-resistant (MDR) HIV-1 protease enzyme derived from a patient failing on several protease inhibitor-containing regimens. This HIV-1 variant contained codon mutations at positions 10, 36, 46, 54, 63, 71, 82, 84, and 90 that confer drug resistance to protease inhibitors. The 1.8-angstrom (Å) crystal structure of this MDR patient isolate reveals an expanded active-site cavity. The active-site expansion includes position 82 and 84 mutations due to the alterations in the amino acid side chains from longer to shorter (e.g., V82A and I84V). The MDR isolate 769 protease “flaps” stay open wider, and the difference in the flap tip distances in the MDR 769 variant is 12 Å. The MDR 769 protease crystal complexes with lopinavir and DMP450 reveal completely different binding modes. The network of interactions between the ligands and the MDR 769 protease is completely different from that seen with the wild-type protease-ligand complexes. The water molecule-forming hydrogen bonds bridging between the two flaps and either the substrate or the peptide-based inhibitor are lacking in the MDR 769 clinical isolate. The S1, S1′, S3, and S3′ pockets show expansion and conformational change. Surface plasmon resonance measurements with the MDR 769 protease indicate higher koff rates, resulting in a change of binding affinity. Surface plasmon resonance measurements provide kon and koff data (Kd = koff/kon) to measure binding of the multidrug-resistant protease to various ligands. This MDR 769 protease represents a new antiviral target, presenting the possibility of designing novel inhibitors with activity against the open and expanded protease forms.