Mark H. Roberts

Specific Strains of Escherichia coli Are Pathogenic for the Endometrium of Cattle and Cause Pelvic Inflammatory Disease in Cattle and Mice

Background Escherichia coli are widespread in the environment and pathogenic strains cause diseases of mucosal surfaces including the female genital tract. Pelvic inflammatory disease (PID; metritis) or endometritis affects ∼40% of cattle after parturition. We tested the expectation that multiple genetically diverse E. coli from the environment opportunistically contaminate the uterine lumen after parturition to establish PID. Methodology/Principal Findings Distinct clonal groups of E. coli were identified by Random Amplification of Polymorphic DNA (RAPD) and Multilocus sequence typing (MLST) from animals with uterine disease and these differed from known diarrhoeic or extra-intestinal pathogenic E. coli. The endometrial pathogenic E. coli (EnPEC) were more adherent and invasive for endometrial epithelial and stromal cells, compared with E. coli isolated from the uterus of clinically unaffected animals. The endometrial epithelial and stromal cells produced more prostaglandin E2 and interleukin-8 in response to lipopolysaccharide (LPS) purified from EnPEC compared with non-pathogenic E. coli. The EnPEC or their LPS also caused PID when infused into the uterus of mice with accumulation of neutrophils and macrophages in the endometrium. Infusion of EnPEC was only associated with bacterial invasion of the endometrium and myometrium. Despite their ability to invade cultured cells, elicit host cell responses and establish PID, EnPEC lacked sixteen genes commonly associated with adhesion and invasion by enteric or extraintestinal pathogenic E. coli, though the ferric yersiniabactin uptake gene (fyuA) was present in PID-associated EnPEC. Endometrial epithelial or stromal cells from wild type but not Toll-like receptor 4 (TLR4) null mice secreted prostaglandin E2 and chemokine (C-X-C motif) ligand 1 (CXCL1) in response to LPS from EnPEC, highlighting the key role of LPS in PID. Conclusions/Significance The implication arising from the discovery of EnPEC is that development of treatments or vaccines for PID should focus specifically on EnPEC and not other strains of E. coli.

Serum total IgE levels and CD14 on chromosome 5q31

To the Editor: Atopy is a complex immune disorder characterised by heightened IgE levels, and it leads to asthma, eczema and rhinitis (1). Genetic linkage analyses for atopic asthma have uncovered several candidate loci including chromosome 5q31-32 (2, 3). This region contains a cytokine gene cluster consisting of IL3, IL4, IL5, IL9, IL12B, IL13 and GMCSF and other important candidate genes, ADRB2 (b2 adrenoceptor), CD14 and GRL (glucocorticoid receptor) (2, 3). The exact localisation, however, still remains controversial (1). The gene encoding CD14 is a single gene spanning 1.5 kb on 5q31 and separated by a single short intron (4). CD14 is the receptor for lipopolysaccaride (LPS) and other bacterial wall-derived components and mainly expressed on macrophages; activation of these cells through CD14 by microbes produces IL-12, which plays a key role in induction of TH1 cells (5). Recently, a −159T/C variant of CD14 promoter has been identified and associated with soluble type CD14 (sCD14) which was correlated with IFNg and inversely with IL-4 levels in a general population in Tucson, AZ, USA (6). These results enable us to hypothesise that CD14 might be the key molecule to regulate TH1/TH2 immune balance by alteration of antigen presentation to naı̈ve T cells or by regulating sCD14 levels. To test whether the variant in the promoter of the CD14 gene relates to atopy and/or asthma, we conducted a genetic association study on largescale British (n=300) and Japanese (n=200) populations. Details of the subject selection, serological assay and DNA extraction were described elsewhere (7). PCR primers to amplify the promoter region were 5% GTGCCAACAGATGAGGTTCAC and 5% CCTCTGTGAACCCTGATCAC, and PCR products were digested with A6aII (6). The allele frequencies for CD14 in two control populations were almost identical to that of the Tucson population and consistent with the Hardy–Weinberg equilibrium: p(−159T)=0.52 and p(−159C)=0.48 in the British, and p(−159T) =0.60 and p(−159C)=0.40 in the Japanese population. As shown in Table 1, there was no significant association for any type of atopy and asthma in either population. However, mean geometric IgE level was lower among those with TT or TC genotype than among those with CC genotype in both populations. This was significant among those with negative RAST [19.493.8 for those with TT or TC genotype vs. 79.492.7 for those with CC genotype, F-value=4.17 (df=2), p= 0.018] in a British population using ANOVA. We have identified a –159T/C promoter variant of CD14 gene, and the homozygous T alleles predicted lower serum IgE levels among Caucasian children with positive skin prick tests (6). This is consistent with our present data in that those with T allele had significantly lower IgE levels than those with C allele in British subjects with negative RAST. These findings support the candidacy of CD14 as the atopy locus on chromosome 5q31.

Toll-like receptor 4 mediates the response of epithelial and stromal cells to lipopolysaccharide in the endometrium.

Background Ascending infections of the female genital tract with bacteria causes pelvic inflammatory disease (PID), preterm labour and infertility. Lipopolysaccharide (LPS) is the main component of the cell wall of Gram-negative bacteria. Innate immunity relies on the detection of LPS by Toll-like receptor 4 (TLR4) on host cells. Binding of LPS to TLR4 on immune cells stimulates secretion of pro-inflammatory cytokines such as IL-6, chemokines such as CXCL1 and CCL20, and prostaglandin E2. The present study tested the hypothesis that TLR4 on endometrial epithelial and stromal cells is essential for the innate immune response to LPS in the female genital tract. Methodology/Principal Findings Wild type (WT) mice expressed TLR4 in the endometrium. Intrauterine infusion of purified LPS caused pelvic inflammatory disease, with accumulation of granulocytes throughout the endometrium of WT but not Tlr4−/− mice. Intra-peritoneal infusion of LPS did not cause PID in WT or Tlr4−/− mice, indicating the importance of TLR4 in the endometrium for the detection of LPS in the female genital tract. Stromal and epithelial cells isolated from the endometrium of WT but not Tlr4−/− mice, secreted IL-6, CXCL1, CCL20 and prostaglandin E2 in response to LPS, in a concentration and time dependent manner. Co-culture of combinations of stromal and epithelial cells from WT and Tlr4−/− mice provided little evidence of stromal-epithelial interactions in the response to LPS. Conclusions/Significance The innate immune response to LPS in the female genital tract is dependent on TLR4 on the epithelial and stromal cells of the endometrium.

Variation in dinucleotide (GT) repeat sequence in the first exon of the STAT6 gene is associated with atopic asthma and differentially regulates the promoter activity in vitro

Upregulation of the IL-4/IL-13 mediated Th2 response is a characteristic of allergic diseases such as asthma, a common and often debilitating disease.1 STAT6 is a critical signalling molecule in the Th2 signalling pathway, and mice lacking STAT6 are protected from allergic pulmonary manifestations.2 The importance of STAT6 in asthma is also evident from studies showing that STAT6 gene expression is markedly upregulated in airway epithelial cells in asthma.3 STAT6 is important in the expression of VCAM-1 in endothelial cells and of chemokines, such as eotaxin, in epithelial cells following stimulation with IL-4 and IL-13.4 As a consequence, STAT6 has been considered a strong candidate for predisposition to atopic asthma. Indeed, the human STAT6 gene is mapped to chromosome 12q13.3−q14.1, a region linked to total serum IgE concentration and atopy in several populations.5 A number of common polymorphisms have been identified, including a GT repeat in exon 1 and three common SNPs (G4219A, A4491G, and A4671G; GenBank AF067575) in the 3′ untranslated region of the human STAT6 gene.6–9 Although all four of these polymorphisms have been shown to be associated with allergic phenotypes in various populations, their functional relevance remains unclear. Dinucleotide repeats are the most frequent of the simple repeats distributed throughout the human genome, and many of these exhibit length polymorphisms. Investigations into the effect of dinucleotide repeats on gene expression have shown enhanced10 or decreased transcriptional activity11,12 in the context of different genes and cell types. These regulatory effects have been proposed to be due, in part, to the fact that dinucleotide repeats have potential to form alternative DNA structures, such as Z-, H- and cruciform DNA.13 The Z-DNA sequences in human genes tend to be located near transcription sites, which makes it possible that they play …

Upregulating promoter polymorphisms of RANTES relate to atopic dermatitis

It has been reported that a functional polymorphism in the promoter of the RANTES gene (−403G/A) is associated with atopic dermatitis in a German population. Although there are several reports on the association of RANTES promoter polymorphisms (−403G/A and −28C/G) with asthma, the association of these polymorphisms with atopic dermatitis has not yet been confirmed in other populations. We therefore aimed to test whether the RANTES promoter polymorphisms relate to atopic dermatitis in a well‐defined Japanese population. We conducted an association study of upregulating promoter polymorphisms of RANTES (−403G/A and −28C/G) in 389 patients with atopic dermatitis and 177 healthy control subjects. There was a significant association between the upregulating variant of RANTES −28G and atopic dermatitis, while −403A variant showed a significant association with atopic dermatitis with high IgE productivity. These results support a role for RANTES promoter polymorphisms in susceptibility to atopic dermatitis.