Taro Shirakawa

Atopy and asthma: genetic variants of IL-4 and IL-13 signalling

Abstract Recent genetic and functional studies highlight the importance of IL-4/IL-13 signalling in the development of asthma and atopy. Here, Taro Shirakawa and colleagues discuss genetic variants of IL-4/IL-13 signalling, and whether they promote asthma or atopy among different ethnic groups.

Genetic variants of NRAMP1 and active tuberculosis in Japanese populations

To the Editor: Tuberculosis is a major public health concern worldwide. Approximately 30% of world’s population is infected with Mycobacterium tuberculosis, and 3000000 people die as a consequence each year. While significant exposure and socioeconomic factors are key elements in the development of tuberculosis, intrinsic host factors, especially genetic susceptibility to this pathogen, are important. Studies of mycobacterial infections in animal models provide compelling evidence for a genetic component of host resistance/susceptibility to this bacillus (1). Early animal experiments identified a single dominant gene, designated Bcg (2). A candidate gene was identified and designated as the natural-resistance-associated-macrophage protein 1 gene (Nramp1) (2). The human homologue of NRAMP1 has been cloned (3, 4) and it is localised on chromosome 2q35 (4). To date, 11 variants including five coding regions, three in the introns, and two in the 3% non-coding region have been identified (5, 6). Early attempts to find a genetic linkage between NRAMP1 and tuberculosis failed (7), but a significant genetic association was found between four variants of NRAMP1 and active M. tuberculosis in west Africans (8). To test whether variants of NRAMP1 relate to active tuberculosis in Japanese populations, we conducted a genetic association study using two independent populations from Tokyo and Osaka. Controls were randomly selected from clients in a commercial medical examination company (9). All patients were newly diagnosed cases of pulmonary tuberculosis, with positive acid-fast bacilli showing in sputum smear specimens; none of them was HIV-positive. We first genotyped 30 patients from each of the two populations for 5% promoter (GT)n (8), INT4 (intron 4) (5), Asn543Asp (5), and 3% untranslated region (UTR) variants (8), previously tested by Bellamy et al. (8); we found that the former two and the latter two were in perfect linkage disequilibrium in our populations, as described (5, 8). We thus focused on genotyping the 5% promoter (GT)n and Asn543Asp variants (5, 8); three alleles, 199bp (designated as allele 1), 201bp (allele 2), and 203bp (allele 3) (10) were identified and imaged by automated sequencer (ABI 310) (5). A weak association was found between Asn543Asp and tuberculosis in the Tokyo population; in contrast, there was a significant association with the 5% promoter (GT)n in both populations (Table 1). Of the four (GT)n alleles, allele 3 has been shown to drive promoter activity after stimulation with lipopoysaccharide, or interferon-g, while alleles 1 and 2 reduce it (10); poor promoter alleles (1 and 2), especially allele 1, thus showed a significantly stronger association with tuberculosis in both populations (Table 1); furthermore, the frequencies of homozygous allele 3 were significantly lower in both tuberculosis populations (Table 1). Since there was no significant difference in genotype frequencies between the two populations, we conducted a combined multivariate analysis on the total of 496 subjects; simple factorial analysis of variance (ANOVA) confirmed that there was no interaction between Asn543 and the 5% promoter (GT)n, and that allele 3 is a significant independent genetic marker for resistance to tuberculosis (f-value=3.24, df=2, p=0.039); by comparison, heterozygosity at the INT4 and 3% UTR loci was the highest risk factor in west Africans (8). In conclusion, we show that variants of NRAMP1 are associated with active tuberculosis in Japanese populations (combined odds ratio= 2.07, 95% confidence interval: 1.32–2.61, p= 0.0003); these findings support the first report in west Africans (8). However, the pattern of allelic association with tuberculosis is different in the

Serum total IgE levels and CD14 on chromosome 5q31

To the Editor: Atopy is a complex immune disorder characterised by heightened IgE levels, and it leads to asthma, eczema and rhinitis (1). Genetic linkage analyses for atopic asthma have uncovered several candidate loci including chromosome 5q31-32 (2, 3). This region contains a cytokine gene cluster consisting of IL3, IL4, IL5, IL9, IL12B, IL13 and GMCSF and other important candidate genes, ADRB2 (b2 adrenoceptor), CD14 and GRL (glucocorticoid receptor) (2, 3). The exact localisation, however, still remains controversial (1). The gene encoding CD14 is a single gene spanning 1.5 kb on 5q31 and separated by a single short intron (4). CD14 is the receptor for lipopolysaccaride (LPS) and other bacterial wall-derived components and mainly expressed on macrophages; activation of these cells through CD14 by microbes produces IL-12, which plays a key role in induction of TH1 cells (5). Recently, a −159T/C variant of CD14 promoter has been identified and associated with soluble type CD14 (sCD14) which was correlated with IFNg and inversely with IL-4 levels in a general population in Tucson, AZ, USA (6). These results enable us to hypothesise that CD14 might be the key molecule to regulate TH1/TH2 immune balance by alteration of antigen presentation to naı̈ve T cells or by regulating sCD14 levels. To test whether the variant in the promoter of the CD14 gene relates to atopy and/or asthma, we conducted a genetic association study on largescale British (n=300) and Japanese (n=200) populations. Details of the subject selection, serological assay and DNA extraction were described elsewhere (7). PCR primers to amplify the promoter region were 5% GTGCCAACAGATGAGGTTCAC and 5% CCTCTGTGAACCCTGATCAC, and PCR products were digested with A6aII (6). The allele frequencies for CD14 in two control populations were almost identical to that of the Tucson population and consistent with the Hardy–Weinberg equilibrium: p(−159T)=0.52 and p(−159C)=0.48 in the British, and p(−159T) =0.60 and p(−159C)=0.40 in the Japanese population. As shown in Table 1, there was no significant association for any type of atopy and asthma in either population. However, mean geometric IgE level was lower among those with TT or TC genotype than among those with CC genotype in both populations. This was significant among those with negative RAST [19.493.8 for those with TT or TC genotype vs. 79.492.7 for those with CC genotype, F-value=4.17 (df=2), p= 0.018] in a British population using ANOVA. We have identified a –159T/C promoter variant of CD14 gene, and the homozygous T alleles predicted lower serum IgE levels among Caucasian children with positive skin prick tests (6). This is consistent with our present data in that those with T allele had significantly lower IgE levels than those with C allele in British subjects with negative RAST. These findings support the candidacy of CD14 as the atopy locus on chromosome 5q31.

Chromosome 11q13 and atopic asthma

Asthma is a complex syndrome in which bronchial inflammation and smooth muscle hyperactivity lead to labile airflow obstruction. The commonest form of asthma is that due to atopy, which is an immune disorder where production of IgE to inhaled antigens leads to bronchial mucosal inflammation. The ultimate origins of asthma are interactive environmental and genetic factors. The genetics is acknowledged to be heterogeneous, and one chromosomal region of interest and controversy has been 11q13. To clarify the nature of the chromosome 11q13 effect in atopy and asthma, we conducted a genetic association study in subjects with marked atopic asthma and matched controls, which incorporated the study of 13 genetic variants over a distance of 10–12 cM and which took account of detailed immune and clinical phenotyping. Association with high IgE levels was limited to the interval flanked by D11S1335 and CD20 in a 0.8‐Mb interval and was greatest for variants of FcɛRIβ and HTm4; these variants also associated with asthma (recurrent wheeze with labile airflow obstruction and need for regular inhaler treatment). At the more telomeric marker, D11S480, variants associated with asthma, but not with high IgE levels. The data might support the possibility of multiple loci relevant to atopic asthma on chromosome 11q13.

Promoter polymorphisms in the IRF3 gene confer protection against systemic lupus erythematosus

In order to identify a novel candidate gene in systemic lupus erythematosus (SLE), we analysed a panel of six genes encoding molecules involved in the type I interferon (IFN) system. We first identified variants in the five genes related to type I IFN pathway by sequencing. Genotyping of a panel of eight selected single-nucleotide polymorphisms (SNPs) in six candidate genes (TLR9, MYD88, IRF3, IRF7, IFNB1, IFNA17) was performed in 137 patients with SLE and matched with 152 healthy controls using polymerase chain reaction-restriction fragment length polymorphism analysis. In functional assay, quantitative real-time polymerase chain reaction was performed to assess constitutive IRF3 mRNA expression in peripheral blood mononuclear cells from healthy subjects with different IRF3 promoter haplotypes. Among eight SNPs genotyped, an IRF3 SNP at –925 was found to be associated with SLE after correction for multiple tests (corrected P = 0.016). Of total five IRF3 SNPs genotyped, the promoter IRF3 SNPs –925A/G and –776C/T showed the most significant association with SLE. With regard to –925A/G, the frequency of GG genotype was significantly decreased among SLE patients compared with the control group (1.5% vs. 9.9%; χ2 = 10.0, P = 0.0015, odds ratio 0.12, 95% confidence interval 0.027–0.554). Our experimental data indicated that constitutive IRF3 mRNA expression was significantly lower in cells carrying the minor G-T/G-T haplotype pair compared with those carrying the major A-C haplotype. In conclusion, we showed that the promoter SNPs of the IRF3 gene were significantly associated with resistance against SLE.

Recent advances in understanding how interleukin 13 signals are involved in the pathogenesis of bronchial asthma.

The prevalence of allergic disease has dramatically increased in recent decades, especially in urban and industrialized areas. Allergic diseases are disorders of the immune system, the results of complex interactions among various genetic and environmental factors. Among them, the important role of interleukin 13 (IL-13), a Th2-type cytokine, has recently emerged in the pathogenesis of bronchial asthma. Based on studies using mice, great attention has been paid to the direct effects of IL-13 on bronchial tissues. In this review, we describe recent advances in understanding the signal transduction mechanism of IL-13, the involvement of IL-13 signal-related genes as genetic factors in the pathogenesis of bronchial asthma, and the expression of IL-13 receptor on bronchial tissues. We describe potential strategies for targeting IL-13 signals to improve allergic states.

Low molecular weight PTP–IL‐4RA interaction in atopy predisposition

We recently described a protective effect of the low molecular weight protein tyrosine phosphatase (LMPTP) BC genotype, associated with the highest total enzymatic activity, against high serum IgE levels both in the English and the Italian populations. Here we test the hypothesis of a role of LMPTP in the negative modulation of IL‐4 signal transduction checking for genetic interaction between interleukin‐4 receptor alpha chain (IL‐4RA) genetic polymorphisms and LMPTP polymorphism in the predisposition to high total IgE levels in the English population. We find a significant interaction between LMPTP polymorphism and the intracellular Gln/Arg polymorphism in position 551 of IL‐4RA. Our data support the hypothesis of a direct or indirect biochemical interaction between LMPTP and IL‐4RA resulting in different modulation of IL‐4 signal transduction among joint genotypes.

Chromosome 11q13, FcɛRlβ and atopic asthma

Atopy is a common disorder characterized by increased general IgE responsiveness [1]. Atopy is also an important cause of disorder in the skin (eczema), lungs (asthma), and nose (rhinitis); family studies suggest variable combinations of organ-specific clinical syndromes in individuals within atopic families [1-10].