Michael Fry

Human Werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)(n)

Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G′2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G′2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3′ or 5′ ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7tetraplex, bimolecular tetraplex structures of a telomeric sequence 5′-d(TAGACATG(TTAGGG)2TTA)-3′, or tetramolecular quadruplex forms of an IgG switch region sequence 5′-d(TACAGGGGAGCTGGGGTAGA)-3′. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.

The Fragile X Syndrome Single Strand d(CGG)n Nucleotide Repeats Readily Fold Back to Form Unimolecular Hairpin Structures

Expansion of a d(CGG)n run within the 5′-untranslated region of the X-linked human gene FMR1 blocks FMR1 transcription, delays its replication, and precipitates the fragile X syndrome. We showed previously that d(CGG)n tracts aggregate into interstrand tetrahelical complexes (Fry, M., and Loeb, L. A.(1994) Proc. Natl. Acad. Sci. U. S. A. 91, 4950-4954). Here we show that these sequences also form under physiological conditions in in vitro unimolecular hairpin structures. Folding is demonstrated by temperature-dependent mobility of d(CGG)n oligomers in a nondenaturing polyacrylamide gel, by UV-hyperchromicity of thermally denaturing oligomers, and by UV cross-linking of compact forms of d(CGG)n runs interspersed by thymidine clusters. That the compact d(CGG)n structures are unimolecular is suggested by their zero-order kinetics of formation. Diethyl pyrocarbonate modification reveals a single, 4-5 residue-long central or epicentral unpaired loop in folded d(CGG)n oligomers. The position of this loop remains unchanged by insertion of thymidine clusters into 15- or 33-mer d(CGG) tracts as indicated by KMnO4 probing of unpaired thymidines. The presence of a single loop in folded d(CGG)n oligomers and the accessibility of every guanine to dimethyl sulfate modification suggest that they are hairpin and not tetraplex structures. Modeling indicates that different d(CGG)nhairpins are stabilized by guanine-guanine Hoogsteen hydrogen bonds or by Hoogsteen and Watson-Crick bonds. If formed in vivo, d(CGG)n hairpins could entail slippage and trinucleotide expansion during replication and could obstruct FMR1 gene transcription and replication.

Purification and Characterization of qTBP42, a New Single-stranded and Quadruplex Telomeric DNA-binding Protein from Rat Hepatocytes

Telomeres of vertebrate chromosomes terminate with a short 5′-d(TTAGGG)-3′ single-stranded overhang that can form in vitro tetrahelical structures. Here we describe a new protein from rat hepatocyte nuclei designated quadruplex telomere-binding protein 42 (qTBP42) that tightly binds 5′-d(TTAGGG)n-3′ and 5′-d(CCCTAA)n-3′ single-stranded and tetraplex forms of 5′d(TTAGGG)n-3′. The thermostable qTBP42 was isolated from boiled nuclear extracts and purified to near homogeneity by successive steps of column chromatography on DEAE-cellulose, phosphocellulose, and phenyl-Sepharose. A subunit molecular size of 42.0 ± 2.0 kDa was determined for qTBP42 by Southwestern blotting and SDS-polyacrylamide gel electrophoresis of the protein and its UV cross-linked complex with labeled telomeric DNA. A native size of 53.5 ± 0.9 kDa, estimated by Superdex© 200 gel filtration, suggests that qTBP42 is a monomeric protein. Sequences of five tryptic peptides of qTBP42 contained motifs shared by a mammalian CArG box-binding protein, hnRNP A/B, hnRNP C, and a human single-stranded telomeric DNA-binding protein. Complexes of qTBP42 with each complementary strand of telomeric DNA and with quadruplex forms of the guanine-rich strand had 3.7-14.6 nM dissociation constants, Kd, whereas complexes with double-stranded telomeric DNA had up to 100-fold higher Kd values. By associating with tetraplex and single-stranded telomeric DNA, qTBP42 increased their heat stability and resistance to digestion by micrococcal nuclease.

The tetraplex (CGG)n destabilizing proteins hnRNP A2 and CBF-A enhance the in vivo translation of fragile X premutation mRNA

Expansion of a (CGG)n sequence in the 5′-UTR of the FMR1 gene to >200–2000 repeats abolishes its transcription and initiates fragile X syndrome (FXS). By contrast, levels of FMR1 mRNA are 5–10-fold higher in FXS premutation carriers of >55–200 repeats than in normal subjects. Lack of a corresponding increase in the amount of the product FMRP protein in carrier cells suggest that (CGG)>55–200 tracts thwart translation. Here we report that a (CGG)99 sequence positioned upstream to reporter firefly (FL) gene selectively diminished mRNA translation in coupled and separate T7 promoter-driven in vitro transcription and translation systems. The (CGG)99 tract similarly depressed mRNA utilization in HEK293 human cells transfected with plasmids bearing FMR1 promoter-driven FL gene. A (CGG)33 RNA tract formed a largely RNase T1-resistant intramolecular secondary structure in the presence of K+ ions. Expression of the quadruplex (CGG)n disrupting proteins hnRNP A2 or CBF-A in HEK293 cells significantly elevated the efficacy of (CGG)99 FL mRNA translation whereas hnRNP A2 or CBF-A mutants lacking quadruplex (CGG)n disrupting activity did not. Taken together, our results suggest that secondary structures of (CGG)n in mRNA obstruct its translation and that quadruplex-disrupting proteins alleviate the translational block.

Sequence-specific Binding Protein of Single-stranded and Unimolecular Quadruplex Telomeric DNA from Rat Hepatocytes

A rat liver nuclear protein, unimolecular quadruplex telomere-binding protein 25, (uqTBP25) is described that binds tightly and specifically single-stranded and unimolecular tetraplex forms of the vertebrate telomeric DNA sequence 5′-d(TTAGGG) n -3′. A near homogeneous uqTBP25 was purified by ammonium sulfate precipitation, chromatographic separation from other DNA binding proteins, and three steps of column chromatography. SDS-polyacrylamide gel electrophoresis and Superdex© 200 gel filtration disclosed for uqTBP25 subunit and nativeM r values of 25.4 ± 0.5 and 25.0 kDa, respectively. Sequences of uqTBP25 tryptic peptides were closely homologous, but not identical, to heterogeneous nuclear ribonucleoprotein A1, heterogeneous nuclear ribonucleoprotein A2/B1, and single-stranded DNA-binding proteins UP1 and HDP-1. Complexes of uqTBP25 with single-stranded or unimolecular quadruplex 5′-d(TTAGGG)4-3′, respectively, had dissociation constants,K d , of 2.2 or 13.4 nm. Relative to d(TTAGGG)4, complexes with 5′-r(UUAGGG)4-3′, blunt-ended duplex telomeric DNA, or quadruplex telomeric DNA had >10 to >250-fold higher K d values. Single base alterations within the d(TTAGGG) repeat increased theK d of complexes with uqTBP25 by 9–215-fold. Association with uqTBP25 protected d(TTAGGG)4 against nuclease digestion, suggesting a potential role for the protein in telomeric DNA transactions.

The quadruplex r(CGG) n destabilizing cationic porphyrin TMPyP4 cooperates with hnRNPs to increase the translation efficiency of fragile X premutation mRNA

The 5′ untranslated region of the FMR1 gene which normally includes 4–55 d(CGG) repeats expands to > 55–200 repeats in carriers of fragile X syndrome premutation. Although the levels of premutation FMR1 mRNA in carrier cells are 5–10-fold higher than normal, the amount of the product FMR protein is unchanged or reduced. We demonstrated previously that premutation r(CGG)n tracts formed quadruplex structures that impeded translation and lowered the efficiency of protein synthesis. Normal translation could be restored in vivo by the quadruplex r(CGG)n destabilizing action of CBF-A and hnRNP A2 proteins. Here we report that the quadruplex-interacting cationic porphyrin TMPyP4 by itself and in cooperation with CBF-A or hnRNP A2 also unfolded quadruplex r(CGG)n and increased the efficiency of translation of 5′-(CGG)99 containing reporter firefly (FL) mRNA. TMPyP4 destabilized in vitro a (CGG)33 intramolecular quadruplex structure and enhanced the translation of 5′-(CGG)99-FL mRNA in a rabbit reticulocyte lysate and in HEK293 cells. The efficiency of translation of (CGG)99-FL mRNA was additively increased in cells exposed to TMPyP4 together with CBF-A. Whereas low doses of TMPyP4, CBF-A or hnRNP A2 by themselves did not affect the in vivo utilization of (CGG)99-FL mRNA, introduction of TMPyP4 together with either protein synergistically augmented its translation efficiency.

Formation and properties of hairpin and tetraplex structures of guanine-rich regulatory sequences of muscle-specific genes

Clustered guanine residues in DNA readily generate hairpin or a variety of tetrahelical structures. The myogenic determination protein MyoD was reported to bind to a tetrahelical structure of guanine-rich enhancer sequence of muscle creatine kinase (MCK) more tightly than to its target E-box motif [K. Walsh and A. Gualberto (1992) J. Biol. Chem., 267, 13714–13718], suggesting that tetraplex structures of regulatory sequences of muscle-specific genes could contribute to transcriptional regulation. In the current study we show that promoter or enhancer sequences of various muscle-specific genes display a disproportionately high incidence of guanine clusters. The sequences derived from the guanine-rich promoter or enhancer regions of three muscle-specific genes, human sarcomeric mitochondrial creatine kinase (sMtCK), mouse MCK and α7 integrin formed diverse secondary structures. The sMtCK sequence folded into a hairpin structure; the α7 integrin oligonucleotide generated a unimolecular tetraplex; and sequences from all three genes associated to generate bimolecular tetraplexes. Furthermore, two neighboring non-contiguous guanine-rich tracts in the α7 integrin promoter region also paired to form a tetraplex structure. We also show that homodimeric MyoD bound bimolecular tetraplex structures of muscle-specific regulatory sequences more efficiently than its target E-box motif. These results are consistent with a role of tetrahelical structures of DNA in the regulation of muscle-specific gene expression.

Tetrahelical Forms of the Fragile X Syndrome Expanded Sequence d(CGG) n Are Destabilized by Two Heterogeneous Nuclear Ribonucleoprotein-related Telomeric DNA-binding Proteins

Formations of hairpin and tetrahelical structures by the trinucleotide repeat sequence d(CGG) n might contribute to its expansion in fragile X syndrome. Here we show that tetraplex structures of d(CGG) n are destabilized by two mammalian heterogeneous nuclear ribonucleoprotein-related tetraplex telomeric DNA-binding and -stabilizing proteins, quadruplex telomeric DNA-binding protein 42 (qTBP42) (Sarig, G., Weisman-Shomer, P., Erlitzki, R., and Fry, M. (1997) J. Biol. Chem. 272, 4474–4482) and unimolecular quadruplex telomeric DNA-binding protein 25 (uqTBP25) (Erlitzki, R., and Fry, M. (1997) J. Biol. Chem. 272, 15881–15890). Blunt-ended and 3′-tailed or 3′- and 5′-tailed bimolecular tetraplex structures of d(CGG) n and guanine-sparse 20-/46-mer partial DNA duplex were progressively destabilized by increasing amounts of qTBP42 or uqTBP25 in time-dependent and ATP- or Mg2+-independent reactions. By contrast, tetraplex structures of telomeric and IgG sequences or guanine-rich double-stranded DNA resisted destabilization by qTBP42 or uqTBP25. Increased stability of tetraplex d(CGG) n in the presence of K+ or Na+ ions or at lowered reaction temperature diminished the destabilizing activity of uqTBP25. The contrasting stabilization of tetraplex telomeric DNA and destabilization of tetraplex d(CGG) n by qTBP42 and uqTBP25 suggested that sequence or structural differences between these tetraplexes might serve as cues for the differential stabilizing/destabilizing activities.

Chick embryo fibroblasts senescence in vitro: Pattern of cell division and life span as a function of cell density

The pattern of cell division, ageing and death of cultured chick embryo fibroblasts inoculated at a wide range of cell densities is described. Cell populations seeded at densities of 2.1 x 10-3 to 3.1 x 10-4 cells per cm-2 double between 39 and 17 times respectively while their life span at all densities remains 57 puls or minus 3 days. Thus, under the experimental conditions employed, the life span of cultured embryonic chick cells is a function of calendar rather than mitotic time. We also find that the duration of phase III and the generation time of the cells during this period are proportional to the density of the culture. Moreover, the division rate of cells inoculated at low densities (4.2-31.0 x 10-2 cells per cm-2) remains constant throughout their entire lifetime. It is suggested that the decline in the proliferative capacity of chick cells ageing in vitro is a function of both their density and their age.

Human Ku Antigen Tightly Binds and Stabilizes a Tetrahelical Form of the Fragile X Syndrome d(CGG) n Expanded Sequence

Hairpin and tetrahelical structures of a d(CGG) n sequence in the FMR1 gene have been implicated in its expansion in fragile X syndrome. The identification of tetraplex d(CGG) n destabilizing proteins (Fry, M., and Loeb, L. A.(1999) J. Biol. Chem. 274, 12797–12803; Weisman-Shomer, P., Naot, Y., and Fry, M. (2000) J. Biol. Chem. 275, 2231–2238) suggested that proteins might modulate d(CGG) n folding and aggregation. We assayed human TK-6 lymphoblastoid cell extracts for d(CGG)8 oligomer binding proteins. The principal binding protein was identified as Ku antigen by its partial amino acid sequence and antigenicity. The purified 88/75-kDa heterodimeric Ku bound with similar affinities (K d ∼1.8–10.2 × 10−9mol/liter) to double-stranded d(CGG)8·d(CCG)8, hairpin d(CGG)8, single-stranded d(CII)8, or tetraplex structures of telomeric or IgG switch region sequences. However, Ku associated more tightly with bimolecular G′2 tetraplex d(CGG)8(K d ∼0.35 × 10−9 mol/liter). Binding to Ku protected G′2 d(CGG)8 against nuclease digestion and impeded its unwinding by the tetraplex destabilizing protein qTBP42. Stabilization of d(CGG) n tetraplex domains inFMR1 by Ku or other proteins might promote d(CGG) expansion and FMR1 silencing.