Nataša Nikolić

Electrical Pulse Stimulation of Cultured Human Skeletal Muscle Cells as an In Vitro Model of Exercise

Background and Aims Physical exercise leads to substantial adaptive responses in skeletal muscles and plays a central role in a healthy life style. Since exercise induces major systemic responses, underlying cellular mechanisms are difficult to study in vivo. It was therefore desirable to develop an in vitro model that would resemble training in cultured human myotubes. Methods Electrical pulse stimulation (EPS) was applied to adherent human myotubes. Cellular contents of ATP, phosphocreatine (PCr) and lactate were determined. Glucose and oleic acid metabolism were studied using radio-labeled substrates, and gene expression was analyzed using real-time RT-PCR. Mitochondrial content and function were measured by live imaging and determination of citrate synthase activity, respectively. Protein expression was assessed by electrophoresis and immunoblotting. Results High-frequency, acute EPS increased deoxyglucose uptake and lactate production, while cell contents of both ATP and PCr decreased. Chronic, low-frequency EPS increased oxidative capacity of cultured myotubes by increasing glucose metabolism (uptake and oxidation) and complete fatty acid oxidation. mRNA expression level of pyruvate dehydrogenase complex 4 (PDK4) was significantly increased in EPS-treated cells, while mRNA expressions of interleukin 6 (IL-6), cytochrome C and carnitin palmitoyl transferase b (CPT1b) also tended to increase. Intensity of MitoTracker®Red FM was doubled after 48 h of chronic, low-frequency EPS. Protein expression of a slow fiber type marker (MHCI) was increased in EPS-treated cells. Conclusions Our results imply that in vitro EPS (acute, high-frequent as well as chronic, low-frequent) of human myotubes may be used to study effects of exercise.

Overexpression of PGC-1α Increases Fatty Acid Oxidative Capacity of Human Skeletal Muscle Cells

We investigated the effects of PGC-1α (peroxisome proliferator-activated receptor γ coactivator-1α) overexpression on the oxidative capacity of human skeletal muscle cells ex vivo. PGC-1α overexpression increased the oxidation rate of palmitic acid and mRNA expression of genes regulating lipid metabolism, mitochondrial biogenesis, and function in human myotubes. Basal and insulin-stimulated deoxyglucose uptake were decreased, possibly due to upregulation of PDK4 mRNA. Expression of fast fiber-type gene marker (MHCIIa) was decreased. Compared to skeletal muscle in vivo, PGC-1α overexpression increased expression of several genes, which were downregulated during the process of cell isolation and culturing. In conclusion, PGC-1α overexpression increased oxidative capacity of cultured myotubes by improving lipid metabolism, increasing expression of genes involved in regulation of mitochondrial function and biogenesis, and decreasing expression of MHCIIa. These results suggest that therapies aimed at increasing PGC-1α expression may have utility in treatment of obesity and obesity-related diseases.

Synthesis and dual PPARα/δ agonist effects of 1,4-disubstituted 1,2,3-triazole analogues of GW 501516

Ten 1,4-disubstituted 1,2,3-triazoles 2a-2j were prepared and tested for their ability to increase oleic acid oxidation in human myotubes using a high-throughput multiwell assay. Compounds 2e (2-{4-[(1-(3-fluoro-4-(trifluoromethyl)phenyl)-1H-1,2,3-triazol-4-yl)methylthio]-2-methylphenoxy}acetic acid) and 2i (2-{4-[(1-(3-chloro-4-(trifluoromethoxy)phenyl)-1H-1,2,3-triazol-4-yl)methylthio]-2-methylphenoxy}acetic acid) exhibited potent agonist activities. Compounds 2e and 2i also exhibited powerful agonist effects for both PPARalpha and PPARdelta in a luciferase-based assay. Consequently, these triazoles can be categorized as dual PPAR agonists.

Remodeling of Oxidative Energy Metabolism by Galactose Improves Glucose Handling and Metabolic Switching in Human Skeletal Muscle Cells

Cultured human myotubes have a low mitochondrial oxidative potential. This study aims to remodel energy metabolism in myotubes by replacing glucose with galactose during growth and differentiation to ultimately examine the consequences for fatty acid and glucose metabolism. Exposure to galactose showed an increased [14C]oleic acid oxidation, whereas cellular uptake of oleic acid uptake was unchanged. On the other hand, both cellular uptake and oxidation of [14C]glucose increased in myotubes exposed to galactose. In the presence of the mitochondrial uncoupler carbonylcyanide p-trifluormethoxy-phenylhydrazone (FCCP) the reserve capacity for glucose oxidation was increased in cells grown with galactose. Staining and live imaging of the cells showed that myotubes exposed to galactose had a significant increase in mitochondrial and neutral lipid content. Suppressibility of fatty acid oxidation by acute addition of glucose was increased compared to cells grown in presence of glucose. In summary, we show that cells grown in galactose were more oxidative, had increased oxidative capacity and higher mitochondrial content, and showed an increased glucose handling. Interestingly, cells exposed to galactose showed an increased suppressibility of fatty acid metabolism. Thus, galactose improved glucose metabolism and metabolic switching of myotubes, representing a cell model that may be valuable for metabolic studies related to insulin resistance and disorders involving mitochondrial impairments.

Palmitic acid follows a different metabolic pathway than oleic acid in human skeletal muscle cells; lower lipolysis rate despite an increased level of adipose triglyceride lipase

Development of insulin resistance is positively associated with dietary saturated fatty acids and negatively associated with monounsaturated fatty acids. To clarify aspects of this difference we have compared the metabolism of oleic (OA, monounsaturated) and palmitic acids (PA, saturated) in human myotubes. Human myotubes were treated with 100μM OA or PA and the metabolism of [(14)C]-labeled fatty acid was studied. We observed that PA had a lower lipolysis rate than OA, despite a more than two-fold higher protein level of adipose triglyceride lipase after 24h incubation with PA. PA was less incorporated into triacylglycerol and more incorporated into phospholipids after 24h. Supporting this, incubation with compounds modifying lipolysis and reesterification pathways suggested a less influenced PA than OA metabolism. In addition, PA showed a lower accumulation than OA, though PA was oxidized to a relatively higher extent than OA. Gene set enrichment analysis revealed that 24h of PA treatment upregulated lipogenesis and fatty acid β-oxidation and downregulated oxidative phosphorylation compared to OA. The differences in lipid accumulation and lipolysis between OA and PA were eliminated in combination with eicosapentaenoic acid (polyunsaturated fatty acid). In conclusion, this study reveals that the two most abundant fatty acids in our diet are partitioned toward different metabolic pathways in muscle cells, and this may be relevant to understand the link between dietary fat and skeletal muscle insulin resistance.

Erratum to “Overexpression of PGC-1α Increases Fatty Acid Oxidative Capacity of Human Skeletal Muscle Cells”

Unfortunately there was a mistake in Figure 7. The primer used for mRNA expression was actually MYH1, which regulates expression of MHC type IIx muscle fibers and not MHC type I as stated in the figure. However, we have repeated the experiment with the correct primer MYH7 (acc_no. NM000257.2, F: CTCTGCACAGGGAAAATCTGAA, R: CCCCTGGAGACTTTGTCTCATT), and the new Figure 7 is shown here. This makes no difference to the conclusions of the paper. There was no significant change in mRNA of MHCI (MYH7), neither was the MHCI/MHCIIa mRNA ratio significantly increased. However, the last sentence in Section 3 (page 7) should be slightly changed: “Thus, the MHCI/MHCIIa mRNA ratio was approximately doubled in cells overexpressing PGC-1α  compared to control cells infected with empty vector (from 4.5 to 9.2, resp.).” Figure 7

PPARδ activation in human myotubes increases mitochondrial fatty acid oxidative capacity and reduces glucose utilization by a switch in substrate preference

Abstract The role of peroxisome proliferator-activated receptor δ (PPARδ) activation on global gene expression and mitochondrial fuel utilization were investigated in human myotubes. Only 21 genes were up-regulated and 3 genes were down-regulated after activation by the PPARδ agonist GW501516. Pathway analysis showed up-regulated mitochondrial fatty acid oxidation, TCA cycle and cholesterol biosynthesis. GW501516 increased oleic acid oxidation and mitochondrial oxidative capacity by 2-fold. Glucose uptake and oxidation were reduced, but total substrate oxidation was not affected, indicating a fuel switch from glucose to fatty acid. Cholesterol biosynthesis was increased, but lipid biosynthesis and mitochondrial content were not affected. This study confirmed that the principal effect of PPARδ activation was to increase mitochondrial fatty acid oxidative capacity. Our results further suggest that PPARδ activation reduced glucose utilization through a switch in mitochondrial substrate preference by up-regulating pyruvate dehydrogenase kinase isozyme 4 and genes involved in lipid metabolism and fatty acid oxidation.

Electrical pulse stimulation of cultured skeletal muscle cells as a model for in vitro exercise – possibilities and limitations

The beneficial health‐related effects of exercise are well recognized, and numerous studies have investigated underlying mechanism using various in vivo and in vitro models. Although electrical pulse stimulation (EPS) for the induction of muscle contraction has been used for quite some time, its application on cultured skeletal muscle cells of animal or human origin as a model of in vitro exercise is a more recent development. In this review, we compare in vivo exercise and in vitro EPS with regard to effects on signalling, expression level and metabolism. We provide a comprehensive overview of different EPS protocols and their applications, discuss technical aspects of this model including critical controls and the importance of a proper maintenance procedure and finally discuss the limitations of the EPS model.

Myotubes from severely obese type 2 diabetic subjects accumulate less lipids and show higher lipolytic rate than myotubes from severely obese non-diabetic subjects.

About 80% of patients with type 2 diabetes are classified as overweight. However, only about 1/3 of severely obese subjects have type 2 diabetes. This indicates that several severely obese individuals may possess certain characteristics that protect them against type 2 diabetes. We therefore hypothesized that this apparent paradox could be related to fundamental differences in skeletal muscle lipid handling. Energy metabolism and metabolic flexibility were examined in human myotubes derived from severely obese subjects without (BMI 44±7 kg/m2) and with type 2 diabetes (BMI 43±6 kg/m2). Lower insulin sensitivity was observed in myotubes from severely obese subjects with type 2 diabetes. Lipolysis rate was higher, and oleic acid accumulation, triacylglycerol content, and fatty acid adaptability were lower in myotubes from severely obese subjects with type 2 diabetes compared to severely obese non-diabetic subjects. There were no differences in lipid distribution and mRNA and protein expression of the lipases HSL and ATGL, the lipase cofactor CGI-58, or the lipid droplet proteins PLIN2 and PLIN3. Glucose and oleic acid oxidation were also similar in cells from the two groups. In conclusion, myotubes established from severely obese donors with established type 2 diabetes had lower ability for lipid accumulation and higher lipolysis rate than myotubes from severely obese donors without diabetes. This indicates that a difference in intramyocellular lipid turnover might be fundamental in evolving type 2 diabetes.

Utilization of lactic acid in human myotubes and interplay with glucose and fatty acid metabolism

Once assumed only to be a waste product of anaerobe glycolytic activity, lactate is now recognized as an energy source in skeletal muscles. While lactate metabolism has been extensively studied in vivo, underlying cellular processes are poorly described. This study aimed to examine lactate metabolism in cultured human myotubes and to investigate effects of lactate exposure on metabolism of oleic acid and glucose. Lactic acid, fatty acid and glucose metabolism were studied in myotubes using [14C(U)]lactic acid, [14C]oleic acid and [14C(U)]glucose, respectively. Myotubes expressed both the MCT1, MCT2, MCT3 and MCT4 lactate transporters, and lactic acid was found to be a substrate for both glycogen synthesis and lipid storage. Pyruvate and palmitic acid inhibited lactic acid oxidation, whilst glucose and α-cyano-4-hydroxycinnamic acid inhibited lactic acid uptake. Acute addition of lactic acid inhibited glucose and oleic acid oxidation, whereas oleic acid uptake was increased. Pretreatment with lactic acid for 24 h did not affect glucose or oleic acid metabolism. By replacing glucose with lactic acid during the whole culturing period, glucose uptake and oxidation were increased by 2.8-fold and 3-fold, respectively, and oleic acid oxidation was increased 1.4-fold. Thus, lactic acid has an important role in energy metabolism of human myotubes.