Obiajulu H. Iwenofu

Aggressive Osteoblastoma of the Maxilla: A Case Report and Review of the Literature

Aggressive osteoblastoma is a rare primary bone neoplasm with the potential for local invasion and recurrence. While the vertebrae or long bones are most commonly affected, few well-documented cases have been reported in the jaws. A 25-year-old man presented with a palatal mass of several months’ duration. He reported the lesion had undergone gradual enlargement and, while generally asymptomatic, had recently become increasingly painful. An incisional biopsy was interpreted as “osteoblastic neoplasm” most suggestive of osteoblastoma. However, final diagnosis was deferred until the resection specimen could be evaluated. Following partial maxillectomy, histopathologic examination revealed a proliferation of large epithelioid cells with eccentric nuclei and prominent nucleoli associated with broad, irregular deposits of osteoid and trabeculae of bone. The lesional cells exhibited minimal pleomorphism with infrequent, normal-appearing mitotic figures and numerous osteoclast-like giant cells were observed within an associated loose fibrovascular stroma. Transformation of “blue bone” to more organized eosinophilic trabeculae of woven bone was noted at the periphery of the lesion and there was no evidence of invasion. A diagnosis of aggressive osteoblastoma was made. Previous reports of gnathic aggressive osteoblastoma are reviewed and the features that distinguish this process from conventional osteoblastoma or osteoblastoma-like osteosarcoma are presented.

Clinicopathologic predictors of recurrence and overall survival in adenoid cystic carcinoma of the head and neck: a single institutional experience at a tertiary care center.

The purpose of this study was to determine factors that impact recurrence and long‐term survival of head and neck adenoid cystic carcinoma (ACC).

Human Sarcomas Are Mosaic for Telomerase-Dependent and Telomerase-Independent Telomere Maintenance Mechanisms: Implications for Telomere-Based Therapies

Telomere shortening necessitates that tumor cells activate a telomere maintenance mechanism (TMM) to support immortalization. Although most tumor cells activate expression of the enzyme telomerase, some cells elongate telomeres in a telomerase-independent manner, termed alternative lengthening of telomeres (ALT). Previous studies have evaluated the presence of telomerase or ALT mechanisms or both in a variety of tumor types. Our studies also show that TMMs are not mutually exclusive in some tumors. In contrast, our IHC analyses of human sarcomas identified a subset of tumors with some cells containing ALT-associated PML bodies, a hallmark of ALT, and separate cells expressing telomerase in the same tumor. By using a second set of human osteosarcomas, we merged IHC and biochemical analyses to characterize more fully the tumor TMM. The IHC data reveal the presence of both telomerase- and ALT-positive tumor cells in samples that demonstrate characteristics of both telomerase and ALT in biochemical assays. These assays, which measure telomere length and telomerase activity of tumor extracts, are conventionally used to classify tumor TMM. Our results suggest that TMM is not a single or perhaps static characteristic of some tumors and that TMM heterogeneity should be considered in tumor stratification. Furthermore, clinical interest in telomere-based therapies may necessitate accurate characterization of tumor TMM before treatment to maximize therapeutic efficacy.

Fulminant and accelerated presentation of dermatomyositis in two previously healthy young adult males: a potential role for endotheliotropic viral infection

Background:  Dermatomyositis (DM) is a prototypic autoimmune syndrome, whereby immune‐based microvascular injury is critical in the pathogenesis of skin lesions and the myopathy. Although not widely recognized or accepted as a pathogenetic trigger, endotheliotropic viral triggers including parvovirus B19 and cytomegalovirus have been linked to DM. At times, the clinical manifestations in DM can be fulminant with acute renal failure because of rhabdomyolysis, respiratory failure and gastrointestinal infarcts.

Pseudosarcomatous Spindle Cell Proliferation With Osteoid Matrix Mimicking Osteosarcoma: A Distinct Histologic Phenotype in Giant Cell Tumor of Bone Following Denosumab Therapy.

Giant cell tumor of bone (GCTB) is a distinct benign locally aggressive neoplasm of bone composed of multinucleated osteoclast-type giant cells and round to oval or spindled mononuclear cells. It comprises 4% to 5% of all primary bone tumors and 18% to 20% of all benign bone tumors, and usually pres

Primary malignant myopericytoma of the left atrium--a tumor of aggressive biological behavior: report of the first case and review of literature.

We report a case of malignant myopericytoma arising in the left atrium with brain, skeletal, and liver metastases, which, to our knowledge, is the first report of this rare entity in this anatomic location. A 52-year-old man presented with progressive blackening of his left field of vision. Magnetic resonance imaging and a computed tomography scan of the brain and thorax showed a heterogeneous mass in the right occipital lobe and a large left atrial floor mass. Excision of the atrial mass showed a circumscribed but unencapsulated malignant spindled neoplasm with a perivascular concentric cellular arrangement punctuated by sheets of tumor necrosis. The cells were round to spindled with eosinophilic cytoplasm and indistinct borders. Focally, the tumor infiltrated cardiac muscle. By immunohistochemistry, the cells were positive for smooth muscle actin and negative for desmin, H-Caldesmon, S-100, HMB-45, and Melan-A. The features were prototypic for malignant myopericytoma. Eight months after initial presentation, the patient is alive with metastatic disease.

Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma.

Alveolar soft part sarcoma (ASPS) is an exquisitely rare sarcoma of unknown histogenesis, with a predilection for adolescents and young adults, characterized by slow progressive clinical course and high frequency of metastases. They are traditionally chemoresistant with very limited treatment options in the metastatic setting. Human cytomegalovirus (HCMV) is a DNA &bgr;-herpes virus and it is characterized by persistent lifelong and latent infection. There is growing evidence to indicate the presence of HCMV proteins and nucleic acids in glioblastoma, medulloblastoma, rhabdomyosarcoma, and a variety of solid organ malignancies of the breast, prostate, lung, and colon at very high prevalence. Immunotherapy-based clinical trials targeting specific cytomegalovirus proteins are currently in progress in the treatment of glioblastoma. Herein, we evaluated for the presence of HCMV proteins (IE1 and pp65), genes (US28 and UL96), and RNA in a cohort of ASPS. Six confirmed cases of ASPS were retrieved and full thickness sections of formalin-fixed paraffin-embedded material were stained for anti-HMCV-IE1 and anti-HCMV-pp65. Any nuclear and/or cytoplasmic staining was considered positive. DNA was purified from 50 µm of formalin-fixed paraffin-embedded material. One hundred nanogram of DNA was amplified using polymerase chain reaction for primers specific to HCMV-US28 (forward: AGCGTGCCGTGTACGTTAC and reverse: ATAAAGACAAGCACGACC) and HCMV-UL96 (forward: ACAGCTCTTAAAGGACGTGATGCG and reverse: ACCGTGTCCTTCAGCTCGGTTAAA) using Promega Taq polymerase. HCMV in situ hybridization was performed. All 6 cases of ASPS were positive for both HCMV-IE1 and HCMV-pp65. Usable DNA was available in 4 of the 6 cases. HCMV-US28 gene was found in 75% (3/4) of cases and HCMV-UL96 gene was detected in 50% (2/4) of cases. Importantly, all cases tested positive for at least 1 gene. HCMV-encoded RNA was identified in 80% (4/5) of cases. The presence of HCMV DNA, RNA along with HCMV protein indicates that HCMV is present in ASPS and may contribute to its pathogenesis.

PAX-8 expression in cutaneous ciliated cysts: evidence for Müllerian origin.

Cutaneous ciliated cysts (CCC) are exquisitely rare, benign cystic lesions demonstrating simple, ciliated epithelial linings reminiscent of fallopian tube epithelium. Most commonly, CCC show a predilection for the lower extremities of young reproductive age women and demonstrate immunohistochemical positivity for estrogen and progesterone receptors, supporting the theory that they are derived from ectopic Müllerian rests. PAX-8 is a paired box gene, important in the development of Müllerian and thyroid organs and has utility in the identification of tumors of Müllerian, renal, and thyroid origin. Prompted by the precedent studies on PAX-8 immunohistochemical expression in tumors of Müllerian origin, this article aimed to explore the utility of this antibody in defining the histogenesis of 2 bona fide cases of CCC, both occurring in young reproductive age women. Herein, 2 prototypic index cases of CCC with strong nuclear positivity for estrogen and progesterone receptors are shown to also have positive nuclear staining for PAX-8, further supporting their likely Müllerian origin. These data support the designation of these lesions as cutaneous Müllerian cysts, distinct from potential ciliated cysts of eccrine origin.

DOG1 (clone K9) is seldom expressed and not useful in the evaluation of pancreatic neoplasms.

DOG1, a transmembrane calcium-regulated chloride channel protein, is a sensitive and specific marker for gastrointestinal stromal tumors compared with other spindle cell and epithelioid neoplasms. Overexpression has also been described in a variety of both benign and malignant epithelial neoplasms. Recently, DOG1 immunoreactivity has been reported in pancreatic solid pseudopapillary tumors (SPT), suggesting a role as a marker for SPT. Utilizing immunohistochemistry, we evaluated DOG1 expression in pancreatic neoplasms to determine the prevalence of staining and establish diagnostic utility. Multiple tissue microarrays (TMA) were created from cores of formalin-fixed paraffin-embedded blocks containing pancreatic adenocarcinomas (n=112), neuroendocrine tumors (n=99), serous cystadenomas (n=28), and SPT (n=14) as well as normal pancreas (n=12). Immunoreactivity for DOG1 (clone K9) was assessed for intensity (1 to 3+), percentage of tumor positivity and location. Of the 99 cases of neuroendocrine tumors, only 2 (2%) were focally positive. Patchy staining was identified in 8 cases (7%) of adenocarcinoma of 1 to 2+ intensity, involving 15% to 80% of the tumor cells and primarily seen in a membranous and luminal distribution. In contrast to a previous report, no DOG1 positivity was observed in SPT, evaluated by both TMA and full sections. The TMAs of serous cystadenomas and normal pancreas were negative for DOG1. Rarely, pancreatic islets displayed granular, cytoplasmic staining. DOG1 antibody clone K9 is not a useful marker for SPT or other primary pancreatic neoplasms. Additional studies may be helpful to evaluate differences between clones of DOG1.

Patterns of major wound complications following multidisciplinary therapy for lower extremity soft tissue sarcoma

The purpose of this study was to determine the pattern and timing of major wound complications (MWCs) in patients at our institution who received multimodality treatment for lower extremity soft tissue sarcoma (LE‐STS) and to evaluate the impact of MWCs on tumor control and patient outcomes.