Habibe Kurt

Massive localized lymphedema: a clinicopathologic study of 46 patients with an enrichment for multiplicity

Massive localized lymphedema is a monstrous tumefactive pseudosarcoma seen in middle-aged morbidly obese adults. Since its initial description in 1998, the etiology remains unknown, although associations with trauma, surgeries, and hypothyroidism have been reported. Herein, we report the largest study of massive localized lymphedema and expand upon its clinicopathologic features. Fifty-four cases from 46 patients were retrospectively identified from the institutional archives of The Ohio State University Wexner Medical Center between 2002 and 2015. Forty-six patients (21 males and 25 females, mean age 50 years) presented with large masses developing over a 5–60-month period. The majority of patients were Caucasian (n=39). All patients were obese with a mean weight of 384.7 lb and a mean body mass index of 59.6 kg/m2. Thirty-six patients had a history of atherosclerotic cardiovascular disease and diabetes mellitus type 2 was present in 22 patients. Eight patients had multifocal massive localized lymphedema. The sites included thigh (n=33), abdomen (n=17), suprapubic region (n=1), mons pubis (n=6), scrotum (n=2), perianal region (n=1), and right flank (n=1). Mostly, the clinical impression was benign processes, including pannus or lymphedema pseudotumor. Grossly, the mean weight was 8237 g and the mean size was 53.2 cm. Histologically, eight cases showed a unique pattern of dystrophic calcifications mimicking hyperchromatic, atypical nuclei that might lead to misdiagnosis of liposarcoma, four cases showed focal metaplastic ossification, and three cases showed multinucleated cells in addition to prototypic features of massive localized lymphedema. We report that this is the largest series of massive localized lymphedema. This is a lesion mostly seen in morbidly obese patients and the thigh is the most common site of involvement. We note a marked racial predilection for Caucasians and a tendency towards multiplicity. We suggest that obesity itself and the related metabolic syndrome have an important role in its pathogenesis.

Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma.

Alveolar soft part sarcoma (ASPS) is an exquisitely rare sarcoma of unknown histogenesis, with a predilection for adolescents and young adults, characterized by slow progressive clinical course and high frequency of metastases. They are traditionally chemoresistant with very limited treatment options in the metastatic setting. Human cytomegalovirus (HCMV) is a DNA &bgr;-herpes virus and it is characterized by persistent lifelong and latent infection. There is growing evidence to indicate the presence of HCMV proteins and nucleic acids in glioblastoma, medulloblastoma, rhabdomyosarcoma, and a variety of solid organ malignancies of the breast, prostate, lung, and colon at very high prevalence. Immunotherapy-based clinical trials targeting specific cytomegalovirus proteins are currently in progress in the treatment of glioblastoma. Herein, we evaluated for the presence of HCMV proteins (IE1 and pp65), genes (US28 and UL96), and RNA in a cohort of ASPS. Six confirmed cases of ASPS were retrieved and full thickness sections of formalin-fixed paraffin-embedded material were stained for anti-HMCV-IE1 and anti-HCMV-pp65. Any nuclear and/or cytoplasmic staining was considered positive. DNA was purified from 50 µm of formalin-fixed paraffin-embedded material. One hundred nanogram of DNA was amplified using polymerase chain reaction for primers specific to HCMV-US28 (forward: AGCGTGCCGTGTACGTTAC and reverse: ATAAAGACAAGCACGACC) and HCMV-UL96 (forward: ACAGCTCTTAAAGGACGTGATGCG and reverse: ACCGTGTCCTTCAGCTCGGTTAAA) using Promega Taq polymerase. HCMV in situ hybridization was performed. All 6 cases of ASPS were positive for both HCMV-IE1 and HCMV-pp65. Usable DNA was available in 4 of the 6 cases. HCMV-US28 gene was found in 75% (3/4) of cases and HCMV-UL96 gene was detected in 50% (2/4) of cases. Importantly, all cases tested positive for at least 1 gene. HCMV-encoded RNA was identified in 80% (4/5) of cases. The presence of HCMV DNA, RNA along with HCMV protein indicates that HCMV is present in ASPS and may contribute to its pathogenesis.

Secondary Philadelphia chromosome acquired during therapy of acute leukemia and myelodysplastic syndrome

The Philadelphia chromosome resulting from t(9;22)(q34;q11.2) or its variants is a defining event in chronic myeloid leukemia. It is also observed in several types of de novo acute leukemia, commonly in B lymphoblastic leukemia, and rarely in acute myeloid leukemia, acute leukemia of ambiguous lineage, and T lymphoblastic leukemia. Acquisition of the Philadelphia chromosome during therapy of acute leukemia and myelodysplastic syndrome is rare. We reported 19 patients, including 11 men and 8 women with a median age of 53 years at initial diagnosis. The diagnoses at initial presentation were acute myeloid leukemia (n = 11), myelodysplastic syndrome (n = 5), B lymphoblastic leukemia (n = 2), and T lymphoblastic leukemia (n = 1); no cases carried the Philadelphia chromosome. The Philadelphia chromosome was detected subsequently at relapse, or at refractory stage of acute leukemia or myelodysplastic syndrome. Of 14 patients evaluated for the BCR-ABL1 transcript subtype, 12 had the e1a2 transcript. In 11 of 14 patients, the diseases before and after emergence of the Philadelphia chromosome were clonally related by karyotype or shared gene mutations. Of 15 patients with treatment information available, 7 received chemotherapy alone, 5 received chemotherapy plus tyrosine kinase inhibitors, 2 received tyrosine kinase inhibitors only, and 1 patient was not treated. Twelve patients had follow-up after acquisition of the Philadelphia chromosome; all had persistent/refractory acute leukemia. Thirteen of 15 patients died a median of 3 months after the emergence of the Philadelphia chromosome. In summary, secondary Philadelphia chromosome acquired during therapy is rare, and is associated with the e1a2 transcript subtype, terminal disease stage, and poor outcome.

An unusual presentation of a small-size synovial sarcoma with an indolent course of over 30 years: a cautionary tale!

To the Editor: Synovial sarcomas are relatively common, accounting for approximately 10% of soft-tissue sarcomas. These tumors typically presents in young adults as slow growing, deepseated, large soft-tissue masses, sometimes associated with pain, with a median age at onset of approximately 30 years and aggressive biological behavior. There are precedent data that show clinically favorable outcomes for minute size (<1cm) synovial sarcomas of the hands and feet after follow-up of 2 to 32.2 years.1 In the majority of cases, the disease duration before surgery ranges from 2 to 4 years, but rare cases of synovial sarcoma has been noted for as long as 10 to 20 years before surgery.2 The (X; 18) (p11; q11) translocation leading to SS18-SSX1/2 fusion genes is the genetic hallmark of synovial sarcoma and indeed have emerged as an independent prognostic indicator of outcome among other prognostic factors including: aged less than 20 years, tumor size <5cm, calcifications, and a peripheral tumor location. Tumors with the SS18SSX1 fusion have a higher rate of proliferation and a shorter metastasisfree survival, whereas the presence of the SS18-SSX2 fusion is a favorable prognostic factor for overall survival.6 We herein report a cautionary case of biopsy proven, small-size synovial sarcoma with molecular confirmation of SS18-SSX2, initially thought to be benign because of its size, resulting in delayed diagnosis of 30 years. A 69-year-old woman presented with a recurrent soft-tissue tumor located on her right forearm. She first noticed pain with swelling 30 years ago. Her pain at that time had progressively worsened and the mass had increased in size. This mass was clinically thought to represent nodular fasciitis and was excised but the specimen was discarded and was not submitted for pathologic evaluation. The tumor recurred 2 years later but patient did not seek any medical attention because she was told it was benign until recently (28 y later), when she developed pain with associated swelling at the site of the original surgery. Magnetic resonance imaging documented a 1.5-cm lesion with intermediate and bright intensity on T1 and STIR sequences in the subcutaneous tissues abutting the tendon of extensor carpi radialis (Fig. 1). The underlying bone and musculature did not demonstrate any abnormalities. The clinical diagnosis was thought to be benign. An incisional biopsy was performed and sections demonstrated fascicles of relatively monomorphic spindle cells with nuclear hyperchromasia disposed in fascicular array with associated dystrophic calcification (Fig. 2A). Individual tumor cells had scant cytoplasm, ill-defined borders with nuclear overlap, and a lack of nuclear pleomorphism. Mitosis was exquisitely rare (<1/10HPF) and tumor necrosis was absent. By immunohistochemistry, the tumor cells were positive for epithelial membrane antigen, calponin, focally positive for S-100 and negative for CD34, pancytokeratin-AE1/3, desmin,

Asteroid bodies in soft-tissue amyloidoma.

To the Editor: Asteroid bodies are stellate acidophilic inclusion bodies, usually 20 to 30 um in size with as many as 30 radiate arms found within the cytoplasm of multinucleated giant cells.1 They were originally described in 1911 in the context of sarcoidosis2 but have since been described in many granulomatous diatheses including idiopathic granulomatous diseases (sarcoidosis, necrobiotic xanthogranuloma with paraproteinemia, and annular elastolytic granuloma), infections (mycobacterial, fungal, parasitic), foreign body giant cell reactions, and tumors (cystic teratoma, fibrocystic mastopathy, and fibroxanthosarcoma).1 Traditionally, they have been thought to represent cytoskeletal elements and consist primarily of vimentin.3 However, evidence from ultrastructural examination has suggested that asteroid bodies are composed of radiating filamentous arms enveloped by a myelin membrane–type material.4 Amyloidoma is a tumoral deposition, typically solitary, composed of amyloid protein without systemic disease and may be associated with a localized plasma cell dyscrasia. Soft-tissue amyloidomas are rare, but occur most commonly in the mediastinum or abdomen, although anecdotal cases involving the spine and extremities have also been reported in the literature.5,6 Asteroid bodies have not been previously described in softtissue amyloidomas to the best of our knowledge. We report herein a case of softtissue amyloidoma showing asteroid bodies. An 89-year-old female presented with a 1-year history of large mass near the posterior left aspect of the T9 vertebral body, which on limited biopsy showed amyloid deposition. There was, however, no prior personal history of malignancy. At patient’s request, this was elected to be followed conservatively with serial computed tomography and magnetic resonance imaging. Computed tomography/magnetic resonance imaging (Fig. 1) performed at the time confirmed a left paraspinal mass at the level of T9 with involvement of the adjacent skeletal structures and spinal canal displacing the spinal cord from left to right. After 12 months of watchful waiting, the mass was reimaged and it showed an interval increase from 4.6 4.1 to 6.1 5.1 cm with associated pain. A vertebrectomy was subsequently performed. Histologic sections showed abundant congophilic eosinophilic amorphous material which on polarized microscopy exhibited apple-green FIGURE 1. Computed tomography (CT) scan of the spine. Coronal CT images through T9 level of the thoracic spine demonstrate a soft-tissue mass in the left paraspinal region with invasion of adjacent osseous structures and spinal cord.

Chronic lymphoproliferative disorder of NK-cells: A single-institution review with emphasis on relative utility of multimodality diagnostic tools

Chronic lymphoproliferative disorder of NK‐cells (CLPD‐NK) manifests as a persistent increase (≥2 × 109/L, for > 6 months) of mature NK‐cells in peripheral blood with an indolent clinical course. The disease is rare, and only limited case series have been published.

Blastic plasmacytoid dendritic cell neoplasm with unusual morphology, MYC rearrangement and TET2 and DNMT3A mutations

A 71-year-old man with a history of relapsed/refractory acute myeloid leukaemia (AML) involving skin and bone marrow was referred to our institution. Bone marrow aspirate films showed medium-sized to large blast cells with slightly irregular nuclear contours, prominent nucleoli and strongly basophilic cytoplasm (top left). Cytochemistry showed the blasts to be negative for myeloperoxidase, periodic acid-Schiff and non-specific esterase. Flow cytometric immunophenotyping showed an aberrant blast population, positive for CD4, CD7, CD13 (dim), CD36 (partial), CD38, CD45 (dim), CD64 (partial/dim), CD123, HLA-DR (bright) and terminal deoxynucleotidyl transferase (TdT) (dim). All other myelomonocytic, T cell, B cell, erythroid, megakaryocytic and plasma cell markers were negative. The bone marrow trephine biopsy and clot specimens showed confluent sheets of blasts (top right) positive for CD123 (strong), TCL1, TCF4 (bottom left) and MYC (bottom right), but negative for CD56. Conventional cytogenetic analysis demonstrated: 46,XY,t(6;8)(p21;q24.3)[5]/47,idem,+18[11]/46,XY[4]. Fluorescence in situ hybridisation (FISH) analysis demonstrated MYC rearrangement in 90% of cells. Targeted next generation sequencing analysis showed DNMT3A p.R882H and TET2 p.Y1631 mutations. The diagnosis was revised to blastic plasmacytoid dendritic cell neoplasm (BPDCN). This case of BPDCN had unusual morphological and immunophenotypic features leading to an initial incorrect diagnosis of AML. Unlike typical BPDCN, the blasts had strongly basophilic cytoplasm and prominent nucleoli, in contrast to most BPDCN cases in which blasts have weakly basophilic, often tapered cytoplasm and open chromatin with inconspicuous or moderately prominent nucleoli. In addition, this case lacked CD56 expression, a rare occurrence in BPDCN, which typically is strongly positive for CD56. Immunohistochemical stains, especially CD123, TCL1 and TCF4, can be helpful for establishing the diagnosis of BPDCN in challenging cases.

Epstein-Barr virus-positive follicular lymphoma

A 66-year-old woman presented with left axillary lymphadenopathy. Excisional biopsy was performed. Histological sections showed fragments of an enlarged lymph node with architecture effaced by a vaguely nodular lymphoid neoplasm. The nodules contained predominantly large atypical cells with vesicular chromatin, multiple small nucleoli and variable amounts of cytoplasm, together with a few scattered small cleaved cells (top left). Mitotic figures and apoptotic bodies were variably noted within the nodules. No definite areas of diffuse involvement were noted. The neoplastic cells were positive for CD20, BCL6 (top right), CD10 (focal), CD30 (bottom left), BCL2 and MUM1(focal). In situ hybridisation studies for Epstein–Barr virus (EBV)-encoded small RNAs (EBER) were also performed, showing clusters of positive cells throughout the follicles (bottom right). Lambda immunoglobulin light chain restricted aberrant B cells expressing CD20, CD19 and CD10 (partial/dim) were also detected by flow cytometric analysis. Overall findings were indicative of follicular lymphoma grade 3A. Epstein–Barr virus-positive follicular lymphoma is rare with a prevalence of 2 6%, as reported in the largest case series (Mackrides et al, 2017). Although the majority of cases show EBER-positivity in >75% of tumour cells, low percentage (~5–10%) of EBER-positivity has also been observed. EBV-positivity has been associated with a high grade follicular lymphoma, rapid progression of disease and CD30 expression.

Characterization of IDH1 p.R132H Mutant Clones Using Mutation-specific Antibody in Myeloid Neoplasms

Isocitrate dehydrogenase 1 (IDH1) and IDH2 mutations occur in a variety of myeloid neoplasms. Immunohistochemistry (IHC)-based direct visualization of mutant clones of hematopoietic cells can be useful for rapid diagnostic screening and for monitoring treatment response. In this study, we first evaluated the sensitivity and specificity of the IDH1 p.R132H mutation-specific antibody by IHC. All IDH1 wild type cases (n=11) and IDH1 mutant cases with a non-p.R132H mutation (n=30) were negative by IHC, demonstrating 100% antibody specificity. All the initial diagnostic specimens with IDH1 p.R132H mutation including acute myeloid leukemia (n=30), myelodysplastic syndromes (MDS) (n=10), MDS/myeloproliferative neoplasms (MPN) (n=4), and MPN (n=5) were positive by IHC, demonstrating 100% antibody sensitivity. Both immature and mature myeloid cells showed immunoreactivity. Erythroid precursors, lymphoid cells, endothelial cells, and osteoblasts were consistently negative by IHC. We then evaluated the follow-up specimens with a known IDH1 mutation status including acute myeloid leukemia (n=23), MDS (n=2), MDS/MPN (n=2), and MPN (n=2). Thirty-three IDH1 p.R132H mutant cases were positive by IHC and 12 IDH1 mutation negative cases were negative by IHC. However, IHC reactivity in up to 25% of bone marrow cells was noted in 8 of 20 polymerase chain reaction-negative cases, all from patients with a known history of IDH1 p.R132H mutation indicating sampling error or a sensitivity issue with molecular tests. These data indicate that IHC is a highly specific and sensitive tool to detect IDH1 p.R132H mutation in bone marrow involved by myeloid neoplasms. In addition, IDH1 p.R132H IHC also allows localization and assessment of the maturation stage of the clones carrying the mutation.