Oliver Hofnagel

Adipophilin-enriched domains in the ER membrane are sites of lipid droplet biogenesis

The prevailing hypothesis of lipid droplet biogenesis proposes that neutral lipids accumulate within the lipid bilayer of the ER membrane from where they are budded off, enclosed by a protein-bearing phospholipid monolayer originating from the cytoplasmic leaflet of the ER membrane. We have used a variety of methods to investigate the nature of the sites of ER–lipid-droplet association in order to gain new insights into the mechanism of lipid droplet formation and growth. The three-dimensional perspectives provided by freeze-fracture electron microscopy demonstrate unequivocally that at sites of close association, the lipid droplet is not situated within the ER membrane; rather, both ER membranes lie external to and follow the contour of the lipid droplet, enclosing it in a manner akin to an egg cup (the ER) holding an egg (the lipid droplet). Freeze-fracture cytochemistry demonstrates that the PAT family protein adipophilin is concentrated in prominent clusters in the cytoplasmic leaflet of the ER membrane closely apposed to the lipid droplet envelope. We identify these structures as sites at which lipids and adipophilin are transferred from ER membranes to lipid droplets. These findings call for a re-evaluation of the prevailing hypothesis of lipid droplet biogenesis.

Butyrophilin controls milk fat globule secretion

The molecular mechanism underlying milk fat globule secretion in mammary epithelial cells ostensibly involves the formation of complexes between plasma membrane butyrophilin and cytosolic xanthine oxidoreductase. These complexes bind adipophilin in the phospholipid monolayer of milk secretory granules, the precursors of milk fat globules, enveloping the nascent fat globules in a layer of plasma membrane and pinching them off the cell. However, using freeze-fracture immunocytochemistry, we find these proteins in locations other than those previously inferred. Significantly, butyrophilin in the residual plasma membrane of the fat globule envelope is concentrated in a network of ridges that are tightly apposed to the monolayer derived from the secretory granule, and the ridges coincide with butyrophilin labeling in the globule monolayer. Therefore, we propose that milk fat globule secretion is controlled by interactions between plasma membrane butyrophilin and butyrophilin in the secretory granule phospholipid monolayer rather than binding of butyrophilin–xanthine oxidoreductase complexes to secretory granule adipophilin.

Proinflammatory Cytokines Regulate LOX-1 Expression in Vascular Smooth Muscle Cells

Objective—Atherogenesis represents a type of chronic inflammation and involves elements of the immune response, eg, the expression of proinflammatory cytokines. In advanced atherosclerotic lesions, lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1) is expressed in endothelial cells, macrophages, and smooth muscle cells (SMCs). In vitro, the expression of LOX-1 is induced by inflammatory cytokines like TNF-&agr; and transforming growth factor (TGF)-&bgr;. Therefore, LOX-1 is thought to be upregulated locally in response to cytokines in vivo. Methods and Results—We determined by reverse-transcription polymerase chain reaction (PCR) and Western blot analysis whether the mediators of the acute phase response in inflammation, IL-1&agr;, IL-1&bgr;, and TNF-&agr;, regulate LOX-1 expression in cultured SMC, and whether this regulation is influenced by peroxisome proliferator-activated receptor &ggr; (PPAR&ggr;). We studied by immunohistochemistry whether these cytokines are spatially correlated with LOX-1 expression in advanced atherosclerotic lesions. We found upregulation of LOX-1 expression in SMC in a dose- and time-dependent manner after incubation with IL-1&agr;, IL-1&bgr;, and TNF-&agr;. Simultaneous incubation with these cytokines at saturated concentrations had an additive effect on LOX-1 expression. The PPAR&ggr; activator, 15d-PGJ2, however, inhibited IL-1&bgr;–induced upregulation of LOX-1. In the intima of atherosclerotic lesions regions of IL-1&agr;, IL-1&bgr;, and TNF-&agr; expression corresponded to regions of LOX-1 expression. Conclusion—We suppose that upregulated LOX-1 expression in SMC of advanced atherosclerotic lesions is a response to these proinflammatory cytokines. Moreover, the proinflammatory effects of these cytokines can be decreased by the antiinflammatory effect of PPAR&ggr;.

Compartmentalization of proteins in lipid droplet biogenesis

Our existing understanding of the structure, protein organization and biogenesis of the lipid droplet has relied heavily on microscopical techniques that lack resolution and the ability to preserve native cellular and protein composition. The electron microscopic technique of freeze-fracture replica immunogold labeling (FRIL) overcomes these problems, and is currently providing new perspectives in the field. Because of the property of frozen lipids to deflect the fracture plane, en face views of the lipid droplet and its component layers are revealed for high resolution visualization. By means of immunogold labeling, proteins involved in the accretion and mobilization of lipids, notably the PAT family proteins, can be localized at and in the droplet. Application of this approach demonstrates that, contrary to prevailing wisdom, the PAT family proteins are not invariably restricted to the surface of the lipid droplet but can occur throughout the core. The notion that lipid droplet biogenesis involves neutral lipid accumulation within the ER membrane bilayer followed by budding off, enclosed by a protein-containing phospholipid monolayer, is not substantiated. Instead, lipid droplets appear to develop externally to both ER membranes at specialized sites in which the ER enwraps the droplet, and the facing leaflets of the ER membrane and droplet surface are enriched in adipophilin. PAT family proteins are not, as often stated, specific to the lipid droplet, but are widely present in the plasma membrane where, under conditions of lipid loading, they adopt a similar configuration to that of specialized sites in the ER. FRIL has further provided new insights into the mechanism of secretion of a special type of lipid droplet, the milk fat globule. These examples highlight the contribution of the FRIL technique to critical appraisal and development of concepts in the lipid droplet field.

Expression of the Novel Scavenger Receptor SR-PSOX in Cultured Aortic Smooth Muscle Cells and Umbilical Endothelial Cells

To the Editor: In the November issue of Arteriosclerosis, Thrombosis, and Vascular Biology , Minami et al1 demonstrated expression of the novel scavenger receptor for phosphatidylserine and oxidized lipoprotein (SR-PSOX) in lipid-laden macrophages accumulated in the intima of human atherosclerotic lesions. Because SR-PSOX seems to be identical to the membrane-anchored chemokine CXCL16,2,3⇓ which may play a dual role in inflammation and homeostasis, Minami et al1 discussed the potential regulation of SR-PSOX by pro-inflammatory cytokines. Although the authors did not detect SR-PSOX in smooth muscle cells (SMCs) and endothelial cells (ECs), they did discuss the possible expression of SR-PSOX in these cell types. Until now, only the expression of the scavenger receptors SR-AI/II,4 CD36,5 and LOX-16 in SMCs has been described. In our studies on the formation of SMC-derived foam cells during atherogenesis, we have focused on the expression of scavenger receptors,7 including SR-PSOX, in SMCs and ECs. We have also investigated the influence of cytokines on the expression of SR-PSOX in SMCs. Reverse transcriptase–polymerase chain reaction (PCR; primers for human SR-PSOX: 5′-TACACGAGGTTCCAGCTCCT-3′ and 5′-GGGGGCTGGT- AGGAAGTAAA-3′, porcine SR-PSOX: 5′-TATGTGGAGGCAGCAG- TGAC-3′ and …

Efficient non-viral transfection of THP-1 cells

Macrophages are an important part of the cellular immune system and play a key role during immune responses. Thus, macrophages are interesting targets in basic and clinical research. Primary monocytes or monocyte-derived macrophages do not proliferate on a suitable scale so that their use for functional studies in vitro is limited. Immortal proliferating cell lines, such as the human THP-1 monocytic leukemia cell line, are therefore often used instead of primary cells. Transfection is a useful tool to study the function of gene products, but transfection of THP-1 monocytes and pre-differentiated THP-1 macrophages with subsequent differentiation into mature THP-1 macrophages using phorbol esters is usually accompanied by a progressive loss of cell viability. In this study, we describe a simple and rapid approach for efficient transfection of THP-1 monocytes and pre-differentiated THP-1 macrophages using a modified Nucleofection-based approach. The protocol maintains cell viability and functionality, thus allowing efficient transfection of THP-1 cells combined with subsequent differentiation of transfected THP-1 cells into mature macrophages.

Pravastatin Inhibits Expression of Lectin-Like Oxidized Low-Density Lipoprotein Receptor-1 (LOX-1) in Watanabe Heritable Hyperlipidemic Rabbits. A New Pleiotropic Effect of Statins

Background—LOX-1, a receptor for oxidized low-density lipoprotein (OxLDL), seems to play a critical role in foam cell formation of macrophages (M&phgr;s) and smooth muscle cells (SMC). Inhibition of LOX-1 expression reduces foam cell formation and might influence lipid core formation in atherosclerotic lesions. Because statins are able to downregulate LOX-1 expression in vitro, we examined if pravastatin can be used to reduce LOX-1 expression and lipid core formation in lesions of Watanabe heritable hyperlipidemic (WHHL) rabbits. Methods and Results—Pravastatin downregulated LOX-1 expression in cultured human M&phgr;s and in cultured human aortic SMCs. Homozygous WHHL rabbits were treated with 50 mg kg−1 d−1 pravastatin for 32 weeks. Immunohistochemical studies revealed that LOX-1 was expressed in intimal M&phgr;s and SMCs of atherosclerotic lesions. The pravastatin-treated rabbits showed, compared with untreated rabbits, a significantly reduced LOX-1 protein and mRNA expression in the aortic arch. Lipid labeling of this aorta region also demonstrated a strong reduction of the ratio of lipid core area/total lesion area in pravastatin-treated rabbits. Conclusions—The in vivo inhibition of LOX-1 expression by pravastatin demonstrated here represents a new pleiotropic effect of pravastatin. This in vivo inhibition of LOX-1 might be one mechanism for the lipid core reducing effect of pravastatin in atherogenesis.

TIP47, a Lipid Cargo Protein Involved in Macrophage Triglyceride Metabolism

Objective—Uptake of lipids by macrophages (M&PHgr;) leads to lipid droplet accumulation and foam cell formation. The PAT family proteins are implicated in lipid droplet formation, but the precise function of the 47-kDa tail interacting protein (TIP47), a member of this family, is poorly defined. The present study was performed to determine the function of TIP47 in M&PHgr; lipid metabolism. Methods and Results—Freeze-fracture cytochemistry demonstrates that TIP47 is present in the plasma membrane of M&PHgr; and is aggregated into clusters when the cells are incubated with oleate. Suppression of adipophilin levels using siRNA knockdown leads to migration of TIP47 from a cytoplasmic pool to the lipid droplet. Further, reduction of TIP47 decreases triglyceride levels, whereas raising TIP47 levels by expression of EGFP-TIP47 shows the opposite effect. Conclusion—Our results show that the TIP47 protein levels directly correlate with triglyceride levels. We propose that TIP47 may act as a carrier protein for free fatty acids and in this way participates in conversion of M&PHgr; into foam cells.

Differential Modulation of Caveolin-1 Expression in Cells of the Vasculature by Statins

Pelat and coworkers1 demonstrated that rosuvastatin decreases caveolin-1 expression in the cardiovasculature of dyslipidemic mice. By decreasing the expression of caveolin-1, an inhibitor of endothelial NO synthase, rosuvastatin treatment promotes endothelial NO synthase function and concomitantly stabilizes heart rate and blood pressure variabilities. Thus, rosuvastatin exerts beneficial effects on vascular function beyond those attributed to its lipid-lowering capacity. The authors presume that caveolin-1 downregulation occurs at the endothelial cell level, although they also envisioned additional effects on other vascular cells involved in atherogenesis. We agree that effects of statins on other cells are indeed to be anticipated. In our studies on the molecular mechanisms underlying lipid trafficking via caveolae in human smooth muscle cells (SMC)2 and macrophages (MΦ), we evaluated caveolin-1 expression in response to the hydrophobic and hydrophilic statins lovastatin and pravastatin using the reverse transcription–polymerase chain reaction on total RNA (primers for human caveolin-1 were as follows: forward, GAGCTGAGCGAGAAGCAAGT; reverse, ACAGCAAGCGGTAAAACCAG; GenBank accession No, NM-001753), with β-actin …

Upregulation of connexin43 gap junctions between neointimal smooth muscle cells

Increased expression of connexin43 gap junctions in smooth muscle cells (SMC) is implicated in the response to primary arterial injury and in the early stages of human coronary atherosclerosis, but the relevance of these findings to restenosis is unknown. Here we investigated the expression of connexin43 gap junctions in restenotic aortas of cholesterol-fed double injured rabbits. Immunofluorescence confocal microscopy was used to evaluate temporal and spatial expression patterns and to characterize the major expressing cell type. Parallel studies were conducted by electron microscopy, in situ hybridization and Northern blot analysis. Connexin43 gap junctions- and connexin43 mRNA-expressing cells were abundant in the media of non-injured control aorta. Following primary injury and 6 weeks cholesterol diet, connexin43 gap junctions were found distributed throughout the primary intimal layer; although medial expression was reduced, the overall mRNA expression level remained similar to that of non-injured controls. After secondary injury, no major change in distribution pattern of connexin43 gap junctions occurred up to day 10, when marked neointimal labeling was observed. This overall pattern persisted, though with some diminution, at later stages. On the mRNA level total connexin43 mRNA expression declined to about 40% of control values within 4 days after secondary injury (P < 0.05), but subsequently increased four-fold, attaining levels double that of non-injured controls in the 10-day group (P < 0.005 versus control and 4 days). At later stages mRNA expression levels returned to values similar to those of non-injured controls. At all stages, connexin43 gap junctions were localized to the SMC, not to macrophages. We conclude that the enhanced gap junction formation may contribute to the coordination of the response of SMC after secondary injury, particularly in the early phase of restenosis.