Robert A. Gramzinski

Synthetic oligodeoxynucleotides containing CpG motifs enhance immunogenicity of a peptide malaria vaccine in Aotus monkeys

Synthetic peptide and recombinant protein vaccines are optimally immunogenic when delivered with an effective adjuvant. Candidate vaccines currently insufficiently immunogenic may induce a protective immunity if they could be delivered with more effective adjuvants. For example, immunogens that induce promising responses when administered to mice with complete and incomplete Freunds adjuvants perform less well in primate animal models where complete Freunds adjuvant is not used. We report the use of synthetic oligodeoxynucleotides containing CpG motifs, the sequences of which are based on immunostimulatory bacterial DNA sequences, to enhance the immune response in Aotus monkeys to a synthetic peptide malaria vaccine. Monkeys were immunized with the synthetic peptide PADRE 45, a synthetic peptide containing amino acid sequences derived from the circumsporozoite protein (CSP) from Plasmodium falciparum, and delivered in an emulsion of saline and Montanide 720, a mannide oleate in oil solution, that also contained one of three oligodeoxynucleotides. The animals receiving oligodeoxynucleotides containing either three or four CpG motifs produced antibodies that bound a recombinant CSP as measured in ELISA, and reacted with P. falciparum sporozoites in a sporozoite immunofluorescent test. These responses were significantly greater than those seen in animals receiving the oligodeoxynucleotide without CpG motifs. These data indicate that oligodeoxynucleotides containing CpG motifs improve immunogenicity of peptide immunogens in non-human primates, and may be immunopotentiators useful in humans.

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

ABSTRACT Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoeliisporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria.

HLA-DR-Promiscuous T Cell Epitopes from Plasmodium falciparum Pre-Erythrocytic-Stage Antigens Restricted by Multiple HLA Class II Alleles

Previously, we identified and established the antigenicity of 17 CD8+ T cell epitopes from five P. falciparum Ags that are restricted by multiple common HLA class I alleles. Here, we report the identification of 11 peptides from the same Ags, cicumsporozoite protein, sporozoite surface protein 2, exported protein-1, and liver-stage Ag-1, that bind between at least five and up to 11 different HLA-DR molecules representative of the most common HLA-DR Ags worldwide. These peptides recall lymphoproliferative and cytokine responses in immune individuals experimentally immunized with radiation-attenuated Plasmodium falciparum sporozoites (irradiated sporozoites) or semi-immune individuals naturally exposed to malaria in Irian Jaya or Kenya. We establish that all peptides are recognized by individuals of each of the three populations, and that the frequency and magnitude of helper T lymphocyte responses to each peptide is influenced by the intensity of exposure to P. falciparum sporozoites. Mean frequencies of lymphoproliferative responses are 53.2% (irradiated sporozoites) vs 22.4% (Kenyan) vs 5.8% (Javanese), and mean frequencies of IFN-γ responses are 66.3% (irradiated sporozoites) vs 27.3% (Kenyan) vs 8.7% (Javanese). The identification of HLA class II degenerate T cell epitopes from P. falciparum validates our predictive strategy in a biologically relevant system and supports the potential for developing a broadly efficacious epitope-based vaccine against malaria focused on a limited number of peptide specificities.

Randomized, Parallel Placebo-Controlled Trial of Primaquine for Malaria Prophylaxis in Papua, Indonesia

Malaria causes illness or death in unprotected travelers. Primaquine prevents malaria by attacking liver-stage parasites, a property distinguishing it from most chemoprophylactics and obviating 4-week postexposure dosing. A daily adult regimen of 30 mg primaquine prevented malaria caused by Plasmodium falciparum and P. vivax for 20 weeks in 95 of 97 glucose-6-phosphate dehydrogenase (G6PD)-normal Javanese transmigrants in Papua, Indonesia. In comparison, 37 of 149 subjects taking placebo in a parallel trial became parasitemic. The protective efficacy of primaquine against malaria was 93% (95% confidence interval [CI] 71%-98%); against P. falciparum it was 88% (95% CI 48%-97%), and >92% for P. vivax (95% CI >37%-99%). Primaquine was as well tolerated as placebo. Mild methemoglobinemia (mean of 3.4%) returned to normal within 2 weeks. Blood chemistry and hematological parameters revealed no evidence of toxicity. Good safety, tolerance, and efficacy, along with key advantages in dosing requirements, make primaquine an excellent drug for preventing malaria in nonpregnant, G6PD-normal travelers.

Randomized, Placebo-Controlled Trial of Atovaquone/Proguanil for the Prevention of Plasmodium falciparum or Plasmodium vivax Malaria among Migrants to Papua, Indonesia

The increasing prevalence of resistance to antimalarial drugs reduces options for malaria prophylaxis. Atovaquone/proguanil (Malarone; GlaxoSmithKline) has been >95% effective in preventing Plasmodium falciparum malaria in lifelong residents of areas of holoendemicity, but data from persons without clinical immunity or who are at risk for Plasmodium vivax malaria have not been described. We conducted a randomized, double-blinded study involving 297 people from areas of nonendemicity in Indonesia who migrated to Papua (where malaria is endemic) < or =26 months before the study period. Subjects received prophylaxis with 1 Malarone tablet (250 mg of atovaquone and 100 mg of proguanil hydrochloride; n=148) or placebo (n=149) per day for 20 weeks. Hematologic and clinical chemistry values did not change significantly. The protective efficacy of atovaquone/proguanil was 84% (95% confidence interval [CI], 44%-95%) for P. vivax malaria, 96% (95% CI, 72%-99%) for P. falciparum malaria, and 93% (95% CI, 77%-98%) overall. Atovaquone/proguanil was well tolerated, safe, and effective for the prevention of drug-resistant P. vivax and P. falciparum malaria in individuals without prior malaria exposure who migrated to Papua, Indonesia.

Strategy for development of a pre-erythrocytic Plasmodium falciparum DNA vaccine for human use

Data generated in the Plasmodium yoelii rodent model indicated that plasmid DNA vaccines encoding the P.yoelii circumsporozoite protein (PyCSP) or 17 kDa hepatocyte erythrocyte protein (PyHEP17) were potent inducers of protective CD8+ T cell responses directed against infected hepatocytes. Immunization with a mixture of these plasmids circumvented the genetic restriction of protective immunity and induced additive protection. A third DNA vaccine encoding the P. yoelii sporozoite surface protein 2 (PySSP2) also induced protection. The P. falciparum genes encoding the homologues of these three protective P. yoelii antigens as well as another P. falciparum gene encoding a protein that is expressed in infected hepatocytes have been chosen for the development of a human vaccine. The optimal plasmid constructs for human use will be selected on the basis of immunogenicity data generated in mice and nonhuman primates. We anticipate that optimization of multi-gene P. falciparum DNA vaccines designed to protect against malaria by inducing CD8+ T cells that target infected hepatocytes will require extensive clinical trials during the coming years.

Malaria DNA vaccines in Aotus monkeys

In preparation for the development of DNA vaccines designed to produce protective antibodies against Plasmodium falciparum antigens (Ag), we conducted studies to optimize antibody responses in Aotus monkeys after immunization with the P. yoelli circumsporozoite (CSP) DNA vaccine. We demonstrate in Aotus monkeys that an intradermal route of immunization with a PyCSP plasmid DNA vaccine generates antibody responses equivalent to a multiple antigen peptide/adjuvant based vaccine, and that these data support the use of the intradermal route for initial studies of the efficacy of DNA vaccines in inducing protective antibodies against P. falciparum antigens in Aotus monkeys.

Atovaquone/Proguanil Therapy for Plasmodium falciparum and Plasmodium vivax Malaria in Indonesians Who Lack Clinical Immunity

Thirty-eight of 295 subjects participating in a randomized, double-blind, placebo-controlled trial of the efficacy of daily administration of atovaquone/proguanil for malaria prevention developed malaria at some time during the 20-week prophylaxis period. These subjects (3 atovaquone/proguanil recipients and 35 placebo recipients) were treated with 4 tablets of atovaquone/proguanil per day for 3 days. Atovaquone/proguanil provided safe, well-tolerated, and effective therapy for uncomplicated malaria in nonimmune Indonesians.

Nucleic Acid Malaria Vaccines

During the twentieth century, the primary approach to malaria prevention has been to interfere with transmission of the parasite between the infected mosquito and the human host using physical barriers, insecticides and prophylactic drugs. Despite these measures, it is estimated that there are 300-500 new Plasmodium infections and 1-2 million deaths annually due to malaria. Thus, there have been major efforts to develop malaria vaccines. This is thought to be a feasible approach because immunization with radiation-attenuated Plasmodium spp. sporozoites induces sterile protective immunity against malaria in rodents, primates and humans(reviewed in Ref. 2). The complex life cycle of the Plasmodium spp. parasites and the extensive variability among strains of the same Plasmodium species dictate, however, that an effective malaria vaccine will probably need to induce protective antibodies as well as effector CD4+ and CD8+ T lymphocytes specific for variants of multiple antigens expressed at different stages of the life cycle. It is our view that nucleic acid vaccines offer an excellent approach to developing a multivalent vaccine that effectively activates all arms of the immune system. Furthermore, such vaccines may overcome the additional problem inherent in subunit vaccine development: major histocompatibility complex (MHC) restriction of the protective immune responses to identified target epitopes. Supporting data and rationale for our view are presented here. The major emphasis of the work thus far has been to use plasmid DNA to induce protective CD8+ cytotoxic T lymphocytes (CTL), but the induction of protective antibody and CD4+ T cell responses is being investigated.

Absence of antigenic competition in Aotus monkeys immunized with Plasmodium falciparum DNA vaccines delivered as a mixture.

Aotus lemurinus lemurinus monkeys were immunized four times with one of three DNA plasmids expressing important Plasmodium falciparum blood stage vaccine candidate proteins or with a mixture containing all three vaccines. The three vaccines encoded sequences from apical merozoite antigen-1 (AMA-1), erythrocyte binding protein-175 (EBA-175) and merozoite surface protein-1 (MSP-1). Antigen-specific enzyme-linked immunosorbant assays (ELISAs) showed no significant differences in antibody titer induced to the three antigens by a single vaccine compared with the titer induced to that same antigen by the trivalent preparation. Results of immunofluorescent antibody assays against erythrocytes infected with asexual blood stage P. falciparum indicated that each of the three monovalent vaccines induced significant antibody responses to whole parasites. The trivalent vaccine mixture induced, after four immunizations, an antibody titer to whole parasites that was 3--12-fold higher than those induced by any of the single vaccines. The fourth immunization with the trivalent vaccine increased the mean antibody in IFAT by more than five-fold.