Ross H. Durland

X-aptamers: A bead-based selection method for random incorporation of druglike moieties onto next-generation aptamers for enhanced binding

By combining pseudorandom bead-based aptamer libraries with conjugation chemistry, we have created next-generation aptamers, X-aptamers (XAs). Several X-ligands can be added in a directed or random fashion to the aptamers to further enhance their binding affinities for the target proteins. Here we describe the addition of a drug (N-acetyl-2,3-dehydro-2-deoxyneuraminic acid), demonstrated to bind to CD44-HABD, to a complete monothioate backbone-substituted aptamer to increase its binding affinity for the target protein by up to 23-fold, while increasing the drugs level of binding 1-million fold.

Approaches to Enhance the Binding Affinity and Nuclease Stability of Triplex Forming Oligonucleotides

Abstract The ability of simple azole nucleosides to promote antiparallel triplex formation at non-homopurine duplex targets was explored. It was also shown that spermidine-cholesterol conjugation is effective in enhancing cellular uptake and stability of oligonucleotides.

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.

Synthesis of Triple Helix Forming Oligonucleotides with a Stretched Phosphodiester Backbone

Abstract Total synthesis of novel DMT-phosphoramidites of thymidine (11 and 15) and 2′-deoxyguanosine (8 and 20) have been accomplished. The utility of these modified building blocks in the preparation of triple helix forming oligodeoxyribonucleotides with a stretched phosphodiester backbone has been evaluated. It was found that the oligonucleotides with extended backbones were unable to enhance the binding to duplex targets containing CG or TA base pairs.

Triplex Forming Oligonucleotide Reagents: Rationalization of DNA Site Selectivity and Application in a Pharmaceutical Context

We show that triplex forming oligonucleotides (TFOs) can be designed against discrete target sites within the human c-myc and human epidermal growth factor receptor promotor. These TFOs bind with high sequence selectivity to functionally important sites in those promotors, with dissociation constants in the 10–9M to 10–7M range at physiological pH, temperature and divalent ion concentration. The distinguishing feature of this class of TFO is that it is stabilized by GGC and TAT triplets, bound in the antiparallel orientation relative to the polypurine-rich strand of the underlying duplex.