Subhadeep Roy

Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells.

CRISPR-Cas-mediated genome editing relies on guide RNAs that direct site-specific DNA cleavage facilitated by the Cas endonuclease. Here we report that chemical alterations to synthesized single guide RNAs (sgRNAs) enhance genome editing efficiency in human primary T cells and CD34+ hematopoietic stem and progenitor cells. Co-delivering chemically modified sgRNAs with Cas9 mRNA or protein is an efficient RNA- or ribonucleoprotein (RNP)-based delivery method for the CRISPR-Cas system, without the toxicity associated with DNA delivery. This approach is a simple and effective way to streamline the development of genome editing with the potential to accelerate a wide array of biotechnological and therapeutic applications of the CRISPR-Cas technology.

Loop and Backbone Modifications of Peptide Nucleic Acid Improve G-Quadruplex Binding Selectivity

Targeting guanine (G) quadruplex structures is an exciting new strategy with potential for controlling gene expression and designing anticancer agents. Guanine-rich peptide nucleic acid (PNA) oligomers bind to homologous DNA and RNA to form hetero-G-quadruplexes but can also bind to complementary cytosine-rich sequences to form heteroduplexes. In this study, we incorporated backbone modifications into G-rich PNAs to improve the selectivity for quadruplex versus duplex formation. Incorporation of abasic sites as well as chiral modifications to the backbone were found to be effective strategies for improving selectivity as shown by UV-melting and surface plasmon resonance measurements. The enhanced selectivity is due primarily to decreased affinity for complementary sequences, since binding to the homologous DNA to form PNA-DNA heteroquadruplexes retains high affinity. The improved selectivity of these PNAs is an important step toward using PNAs for regulating gene expression by G-quadruplex formation.

Recent advances in the development of peptide nucleic acid as a gene-targeted drug

Peptide nucleic acid (PNA) is a non-ionic mimic of DNA that binds to complementary DNA and RNA sequences with high affinity and selectivity. Targeting of single-stranded RNA leads to antisense effects, whereas PNAs directed toward double-stranded DNA exhibit antigene properties. Recent advances in cell uptake and in antisense and antigene effects in biological systems are summarised in this review. In addition to traditional targets, namely genomic DNA and messenger RNA, applications for PNA as a bacteriocidal antibiotic, for regulating splice site selection and as a telomerase inhibitor are described.

Synthesis of DNA/RNA and Their Analogs via Phosphoramidite and H-Phosphonate Chemistries

The chemical synthesis of DNA and RNA is universally carried out using nucleoside phosphoramidites or H-phosphonates as synthons. This review focuses on the phosphorus chemistry behind these synthons and how it has been developed to generate procedures whereby yields per condensation approach 100% with very few side products. Additionally the synthesis and properties of certain DNA and RNA analogs that are modified at phosphorus will also be discussed. These analogs include boranephosphonates, metallophosphonates, and alkylboranephosphines.

Kinetic Discrimination in Recognition of DNA Quadruplex Targets by Guanine-Rich Heteroquadruplex-Forming PNA Probes

Guanine-rich peptide nucleic acid probes hybridize to DNA G quadruplex targets with high affinity, forming PNA-DNA heteroquadruplexes. We report a surprising degree of kinetic discrimination for PNA heteroquadruplex formation with a series of DNA targets. The fastest hybridization is observed for targets folded into parallel morphologies.

Strand Invasion of DNA Quadruplexes by PNA: Comparison of Homologous and Complementary Hybridization

Molecular recognition of DNA quadruplex structures is envisioned to be a strategy for regulating gene expression at the transcriptional level and for in situ analysis of telomere structure and function. The recognition of DNA quadruplexes by peptide nucleic acid (PNA) oligomers is presented here, with a focus on comparing complementary, heteroduplex‐forming and homologous, heteroquadruplex‐forming PNAs. Surface plasmon resonance and optical spectroscopy experiments demonstrated that the efficacy of a recognition mode depended strongly on the target. Homologous PNA readily invades a quadruplex derived from the promoter regulatory region found upstream of the MYC proto‐oncogene to form a heteroquadruplex at high potassium concentration mimicking the intracellular environment, whereas complementary PNA exhibits virtually no hybridization. In contrast, complementary PNA is superior to the homologous in hybridizing to a quadruplex modeled on the human telomere sequence. The results are discussed in terms of the different structural morphologies of the quadruplex targets and the implications for in vivo recognition of quadruplexes by PNAs.

Improving CRISPR–Cas specificity with chemical modifications in single-guide RNAs

Abstract CRISPR systems have emerged as transformative tools for altering genomes in living cells with unprecedented ease, inspiring keen interest in increasing their specificity for perfectly matched targets. We have developed a novel approach for improving specificity by incorporating chemical modifications in guide RNAs (gRNAs) at specific sites in their DNA recognition sequence (‘guide sequence’) and systematically evaluating their on-target and off-target activities in biochemical DNA cleavage assays and cell-based assays. Our results show that a chemical modification (2′-O-methyl-3′-phosphonoacetate, or ‘MP’) incorporated at select sites in the ribose-phosphate backbone of gRNAs can dramatically reduce off-target cleavage activities while maintaining high on-target performance, as demonstrated in clinically relevant genes. These findings reveal a unique method for enhancing specificity by chemically modifying the guide sequence in gRNAs. Our approach introduces a versatile tool for augmenting the performance of CRISPR systems for research, industrial and therapeutic applications.

Correction to “Silver Nanoassemblies Constructed from Boranephosphonate DNA”

The following correction is required for the DNA sequences used to prepare the A-tile as used in these arrays. On page S22 of the Supporting Information, a typographical error within the sequences of DNA oligomers A4 and A5 used for the construction of the DNA arrays led to an insertion of an extra base pair in the A-tile. These were typographical errors and were not present in the DNAs used to construct the arrays. The correct sequences are given here and in the corrected Supporting Information: A1: GATGGCGACATCCTGCCGCTATGATTACACAGCCTGAGCATTGACAC A2: GTAGCGCCGTTAGTGGATGTC A3: TGTAGTATCGTGGCTGTGTAATCATAGCGGCACCAACTGGCA A4: GACTGCGTGTCAATGCTCACCGATCAACCAG A5: CTGACGCTGGTTGATCGGACGATACTACATGCCAGTTGGACTAACGG B1a: CAGTGACCGCATCGGACAGCAGC‐T B1b: CGCTACCGTGCATCATGGACTAAC B2: CGTCAGGCTGCTGTGGTCGTGC B3: AGTACAACGCCACCGATGCGGTCACTGGTTAGTGGATTGCGT B4: GCCATCCGTCGATACGGCACCATGATGCACG B5: GCAGTCGCACGACCTGGCGTCTGTTGGCTTTTGCCAACAGTTTGTACTACGCAATCCTGCCGTATCGACG The sequences reported by Winfree et al. were used. In B1a, an extra thymidine residue at the 3′ end was added as a convenience for synthesis of boranephosphonate DNA. It allowed the use of commercially available solid support linked 2′-deoxythymidine. The quality of the arrays was not altered by the addition of this terminal nucleotide. We note in the Winfree et al. manuscript as referenced here that hairpin looped structures extending above/below the arrays were added without affecting the tiles. The following comments are added in order to clarify various questions regarding the original publication:

Pyridinium Boranephosphonate Modified DNA Oligonucleotides

The synthesis of previously unknown derivatives of boranephosphonate that contain amine substitutions at boron and the incorporation of these derivatives into the backbone of DNA oligonucleotides is described. These derivatives result from iodine-mediated replacement of one BH3 hydride of a boranephosphonate linkage by pyridine, various substituted pyridines, other aromatic amines, and certain unsaturated amines. Oligonucleotides containing these backbone modifications show enhanced uptake, relative to unmodified DNA, in mammalian cells. The redox behavior of the boranephosphonate and pyridinium boranephosphonate conjugated linkages has also been studied.