Subrata Pal

Hydrogen-bond dynamics near a micellar surface: origin of the universal slow relaxation at complex aqueous interfaces

The dynamics of hydrogen bonds among water molecules themselves and with the polar head groups (PHG) at a micellar surface have been investigated by long molecular dynamics simulations. The lifetime of the hydrogen bond between a PHG and a water molecule is found to be much longer than that between any two water molecules, and is likely to be a general feature of hydrophilic surfaces of organized assemblies. Analyses of individual water trajectories suggest that water molecules can remain bound to the micellar surface for more than 100 ps. The activation energy for such a transition from the bound to a free state for the water molecules is estimated to be about 3.5 kcal/mol.

Temperature dependence of water dynamics at an aqueous micellar surface: Atomistic molecular dynamics simulation studies of a complex system

In order to study the temperature dependence of water dynamics at the surface of a self-organized assembly, we perform long atomistic molecular dynamics simulations of a micelle of cesium pentadecafluorooctanoate in water at two different temperatures, 300 and 350 K. Since this micellar system is stable over a range of temperature, a detailed study of the microscopic dynamics of water at the surface of the micelle at both temperatures could be performed. The diffusion and dipolar orientational correlation function of the water molecules and the polar solvation dynamics of cesium ions at the micellar surface are calculated as a function of their location from the micellar surface. Our study reveals a strong temperature dependence. The relaxation of both the time correlation functions are highly nonexponential, and become very slow at 300 K. It is found that while the slowness in the orientational time correlation function originates partly from the formation of bridge hydrogen bonds between the polar head groups (PHG) of the micelle and the water molecules, the solvation dynamics slows down primarily due to the interaction of the positive cesium ions with the negatively charged PHGs.

Dynamics of bound and free water in an aqueous micellar solution: analysis of the lifetime and vibrational frequencies of hydrogen bonds at a complex interface

In order to understand the nature and dynamics of interfacial water molecules on the surface of complex systems, large scale, fully atomistic molecular dynamics simulations of an aqueous micelle of cesium perfluorooctanoate (CsPFO) surfactant molecules have been carried out. The lifetime and the intermolecular vibrational frequencies of the hydrogen bonds that the water molecules form with the hydrophilic, polar head groups (PHG) of the surfactants are calculated. Our earlier classification [S. Balasubramanian et al., Curr. Sci. 84, 428 (2003); e-print cond-mat/0212097] of the interfacial water molecules, based on structural and energetic considerations, into bound and free types is further validated by their dynamics. Lifetime correlation functions of the water-surfactant hydrogen bonds show the long-lived nature of the bound water species. Surprisingly, the water molecules that are singly hydrogen bonded to the surfactants have a longer lifetime than those that form two such hydrogen bonds. The free water molecules that do not form any such hydrogen bonds behave similarly to bulk water in their reorientational dynamics. A few water molecules that form two such hydrogen bonds are orientationally locked in for durations of the order of a few hundreds of picoseconds; that is, much longer than their average lifetime. The intermolecular vibrational frequencies of these interfacial water molecules have been studied from the power spectra of their velocity autocorrelation function. We find a significant blue shift in the librational band of the interfacial water molecules, apart from a similar shift in the near neighbor bending modes, relative to water molecules in bulk. These blue shifts suggest an increase in rigidity in the structure around interfacial water molecules. This is in good agreement with recent incoherent, inelastic neutron scattering data on macromolecular solutions [S. Ruffle et al., J. Am. Chem. Soc. 124, 565 (2002)]. The results of the present simulations appear to be rather general and should be relevant to the understanding of the dynamics of water near any hydrophilic surface.

Exploring DNA groove water dynamics through hydrogen bond lifetime and orientational relaxation

Dynamics of water molecules in the grooves of DNA are of great interest both for practical (functionality of DNA) and fundamental (as examples of confined systems) interest. Here the authors employ atomistic molecular dynamics simulations to understand varying water dynamics at the minor and the major grooves of a 38 base-pair long DNA duplex in water. In order to understand and quantify the diversity in the nature of hydrogen bond due to many hydrogen bond donors and acceptors present in the four bases, they have undertaken study of hydrogen bond lifetime (HBLT) correlation functions of all the specific hydrogen bonds between the base atoms and water molecules. They find that the HBLT correlation functions are in general multiexponential, with the average lifetime depending significantly on the specificity and may thus be biologically relevant. The average hydrogen bond lifetime is longer in the minor groove than that in the major groove by almost a factor of 2. Analysis further shows that water hydrogen bonds with phosphate oxygen have substantially shorter lifetimes than those with the groove atoms. They also compute two different orientational time correlation functions (OTCFs) of the water molecules present at the major and the minor grooves and attempt to correlate OTCF with HBLT correlation function. The OTCFs in the minor groove exhibit three time scales, with the time constant of the slowest component one to two orders of magnitude longer than what is observed for bulk water. A slow component is also present for the major groove water but with shorter time constant. Interestingly, correlation between reformations allowed HBLT correlation function [C(HB)(t)] and the OTCF markedly deviates from each other in the grooves, indicating enhanced rigidity of water molecules in the grooves.

Hydrogen Bond Breaking Mechanism and Water Reorientational Dynamics in the Hydration Layer of Lysozyme

The mechanism and the rate of hydrogen bond-breaking in the hydration layer surrounding an aqueous protein are important ingredients required to understand the various aspects of protein dynamics, its function, and stability. Here, we use computer simulation and a time correlation function technique to understand these aspects in the hydration layer of lysozyme. Water molecules in the layer are found to exhibit three distinct bond-breaking mechanisms. A large angle orientational jump of the donor water molecule is common among all of them. In the most common ( approximately 80%) bond-breaking event in the layer, the new acceptor water molecule comes from the first coordination shell (initially within 3.5 A of the donor), and the old acceptor water molecule remains within the first coordination shell, even after the bond-breaking. This is in contrast to that in bulk water, in which both of the acceptor molecules involve the second coordination shell. Additionally, the motion of the incoming and the outgoing acceptor molecules involved is not diffusive in the hydration layer, in contrast to their observed diffusive motion in the bulk. The difference in rotational dynamics between the bulk and the hydration layer water molecules is clearly manifested in the calculated time-dependent angular van Hove self-correlation function ( G(theta, t)) which has a pronounced two-peak structure in the layer, and this can be traced to the constrained translational motion in the layer. The longevity of the surrounding hydrogen bond network is found to be significantly enhanced near a hydrophilic residue.

Enhanced tetrahedral ordering of water molecules in minor grooves of DNA: relative role of DNA rigidity, nanoconfinement, and surface specific interactions.

Confinement and surface specific interactions can induce structures otherwise unstable at that temperature and pressure. Here we study the groove specific water dynamics in the nucleic acid sequences, poly-AT and poly-GC, in long B-DNA duplex chains by large scale atomistic molecular dynamics simulations, accompanied by thermodynamic analysis. While water dynamics in the major groove remains insensitive to the sequence differences, exactly the opposite is true for the minor groove water. Much slower water dynamics observed in the minor grooves (especially in the AT minor) can be attributed to an enhanced tetrahedral ordering () of water. The largest value of in the AT minor groove is related to the spine of hydration found in X-ray structure. The calculated configurational entropy (S(C)) of the water molecules is found to be correlated with the self-diffusion coefficient of water in different region via Adam-Gibbs relation D = A exp(-B/TS(C)), and also with .

Anomalous dielectric relaxation of water molecules at the surface of an aqueous micelle

Dielectric relaxation of aqueous solutions of micelles, proteins, and many complex systems shows an anomalous dispersion at frequencies intermediate between those corresponding to the rotational motion of bulk water and that of the organized assembly or macromolecule. The precise origin of this anomalous dispersion is not well-understood. In this work we employ large scale atomistic molecular dynamics simulations to investigate the dielectric relaxation (DR) of water molecules in an aqueous micellar solution of cesium pentadecafluorooctanoate. The simulations clearly show the presence of a slow component in the moment-moment time correlation function [PhiMW(t)] of water molecules, with a time constant of about 40 ps, in contrast to only 9 ps for bulk water. Interestingly, the orientational time correlation function [Cmu(t)] of individual water molecules at the surface exhibits a component with a time constant of about 19 ps. We show that these two time constants can be related by the well-known micro-macrorelations of statistical mechanics. In addition, the reorientation of surface water molecules exhibits a very slow component that decays with a time constant of about 500 ps. An analysis of hydrogen bond lifetime and of the rotational relaxation in the coordinate frame fixed on the micellar body seems to suggest that the 500 ps component owes its origin to the existence of an extended hydrogen bond network of water molecules at the surface. However, this ultraslow component is not found in the total moment-moment time correlation function of water molecules in the solution. The slow DR of hydration water is found to be well correlated with the slow solvation dynamics of cesium ions at the water-micelle interface.

Hydration dynamics of protein molecules in aqueous solution: Unity among diversity

AbstractDielectric dispersion and NMRD experiments have revealed that a significant fraction of water molecules in the hydration shell of various proteins do not exhibit any slowing down of dynamics. This is usually attributed to the presence of the hydrophobic residues (HBR) on the surface, although HBRs alone cannot account for the large amplitude of the fast component. Solvation dynamics experiments and also computer simulation studies, on the other hand, repeatedly observed the presence of a non-negligible slow component. Here we show, by considering three well-known proteins (lysozyme, myoglobin and adelynate kinase), that the fast component arises partly from the response of those water molecules that are hydrogen bonded with the backbone oxygen (BBO) atoms. These are structurally and energetically less stable than those with the side chain oxygen (SCO) atoms. In addition, the electrostatic interaction energy distribution (EIED) of individual water molecules (hydrogen bonded to SCO) with side chain oxygen atoms shows a surprising two peak character with the lower energy peak almost coincident with the energy distribution of water hydrogen bonded to backbone oxygen atoms (BBO). This two peak contribution appears to be quite general as we find it for lysozyme, myoglobin and adenylate kinase (ADK). The sharp peak of EIED at small energy (at less than 2 kBT) for the BBO atoms, together with the first peak of EIED of SCO and the HBRs on the protein surface, explain why a large fraction (~ 80%) of water in the protein hydration layer remains almost as mobile as bulk water. Significant slowness arises only from the hydrogen bonds that populate the second peak of EIED at larger energy (at about 4 kBT). Thus, if we consider hydrogen bond interaction alone, only 15–20% of water molecules in the protein hydration layer can exhibit slow dynamics, resulting in an average relaxation time of about 5–10 ps. The latter estimate assumes a time constant of 20–100 ps for the slow component. Interestingly, relaxation of water molecules hydrogen bonded to back bone oxygen exhibit an initial component faster than the bulk, suggesting that hydrogen bonding of these water molecules remains frustrated. This explanation of the heterogeneous and non-exponential dynamics of water in the hydration layer is quantitatively consistent with all the available experimental results, and provides unification among diverse features. Graphical AbstractThis study reveals a bimodal electrostatic energy distribution of protein–water hydrogen bonds involving side chain oxygen and faster than bulk water hydrogen bond breaking dynamics of protein–water hydrogen bond involving backbone oxygen.

Intermittency, current flows, and short time diffusion in interacting finite sized one-dimensional fluids

Long time molecular dynamics simulations of one-dimensional Lennard-Jones systems reveal that while the diffusion coefficient of a tagged particle indeed goes to zero in the very long time, the mean-square displacement is linear with time at short to intermediate times, allowing the definition of a short time diffusion coefficient [Lebowitz and Percus, Phys. Rev. 155, 122 (1967)]. The particle trajectories show intermittent displacements, surprisingly similar to the recent experimental results [Wei et al., Science 287, 625 (2000)]. A self-consistent mode coupling theory is presented which can partly explain the rich dynamical behavior of the velocity correlation function and also of the frequency dependent friction. The simulations show a strong dependence of the velocity correlation function on the size of the system, quite unique to one dimensional interacting systems. Inclusion of background noise leads to a dramatic change in the profile of the velocity time correlation function, in agreement with the predictions of Percus [Phys. Rev. A 9, 557 (1974)].

Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is subdiffusive, with mean square displacement (MSD) growing as