Takao Yoshihara

Myelodysplasia and acute myeloid leukaemia in cases of aplastic anaemia and congenital neutropenia following G-CSF administration.

Summary. Myelodysplasia and acute myeloid leukaemia (MDS/AML) developed in three cases of severe aplastic anaemia (SAA) and one case of congenital neutropenia (CN, Kostmanns disease) who received recombinant human granulocyte colony‐stimulating factor (G‐CSF) are reported. In these four MDS/AML cases, age at diagnosis of SAA/CN was 0–13 years, the cumulative dose of G‐CSF was 98 μg/kg to 10 mg/kg over 1–57 months, and the interval from initiation of G‐CSF to MDS/AML was 25, 23, 31 and 57 months, respectively. These results suggest a link between SAA/CN and MDS/AML in relation to G‐CSF administration; however, large studies are necessary to determine if such a risk is significant in patients with SAA/CN who are treated with G‐CSF.

Evaluation of Angiopoietins and Cell-Derived Microparticles after Stem Cell Transplantation

Although stem cell transplantation (SCT) is being used for hematopoietic reconstitution following high-dose chemotherapy for malignancy, it involves certain serious transplant-related complications such as graft-versus-host disease (GVHD). Angiopoietins play important roles in angiogenesis. However, the role of angiopoietins after SCT is poorly understood. In this study, 52 patients underwent SCT; 26 patients received allogeneic SCT, while the remaining 26 received autologous SCT. In 48 of 52 patients, levels of angiopoietins, cytokines, and soluble factors were measured by enzyme-linked immunosorbent assay. Soluble Fas ligand (sFasL) and endothelial cell-derived microparticle (EDMP) exhibited significant elevation in the early phase (2-3 weeks) after SCT. In addition, the elevation of interleukin (IL)-6, tumor necrosis factor (TNF)-alpha, and sIL-2 receptor (sIL-2R), which are GVHD markers after allogeneic SCT was observed. The level of angiopoietin (Ang)-2 in allogeneic SCT continued to increase for up to 4 weeks, although the level of Ang-1 did not show significant changes. The patients with high Ang-2 exhibited significant increase of sFasL and EDMP compared with those with low Ang-2. In addition, the patients with high-grade GVHD exhibited a significant increase in Ang-2 compared to patients with low-grade GVHD. In the in vitro experiment using endothelial cells, the suppressive effect of Ang-1 on EDMP generation by TNF-alpha was partially inhibited by the addition of Ang-2. Furthermore, multivariate regression analysis showed that EDMP and sFasL were significant factors in Ang-2 elevation. Our results suggest that Ang-2 generation after allogeneic SCT relates to GVHD.

Adenoviral infection in hematopoietic stem cell transplantation: early diagnosis with quantitative detection of the viral genome in serum and urine

Summary:Early diagnosis and prompt introduction of effective therapy are imperative to manage systemic, often fatal adenoviral (AdV) disease following hematopoietic stem cell transplantation (SCT). We evaluated the usefulness of real-time polymerase chain reaction (PCR) in the diagnosis of AdV disease in SCT recipients. Seven SCT recipients, including three with AdV disease, were retrospectively evaluated for AdV genome detection. In serum specimens, the AdV genome was detected at >103 copies/ml in the pre-SCT period in two of the five recipients studied. These two patients subsequently developed AdV disease. The three patients with AdV disease had high levels of >105 copies/ml during the 4–6 weeks post-SCT period. In none of these patients was the AdV genome detected in urine specimens in pre-SCT period. However, three recipients with detectable urinary levels during the period 1–2 weeks post-SCT subsequently developed AdV disease. Regarding the outcome, two of the three patients with AdV disease died of progressive renal failure. Our results suggest that quantitative determination of the AdV genome in serum and urine is useful to identify patients at high risk of developing AdV disease. Prospectively applied, these measures are expected to improve the dismal outcome of AdV disease in SCT recipients.

Acute renal failure due to adenovirus-associated obstructive uropathy and necrotizing tubulointerstitial nephritis in a bone marrow transplant recipient.

Summary:Management of post-transplant complications caused by severe adenoviral infection remains a major therapeutic challenge. A 17-year-old male who had undergone bone marrow transplantation for the treatment of acute lymphoblastic leukemia developed complete anuria following hemorrhagic cystitis 34 days after the transplant procedure. The computed tomogram scan revealed bilateral hydronephrosis, indicating acute renal failure because of obstructive uropathy. The emergency procedure of percutaneous nephrostomy caused massive bleeding in the left kidney, which eventually required a nephrectomy. Adenovirus-positive severe necrotizing tubulointerstitial nephritis was the histopathological diagnosis. Post-transplant acute renal failure because of hydronephrosis, which could be complicated by adenovirus-induced renal parenchymal disease, is of great concern and may cause significant problems with interventional treatment.

Potential use of procalcitonin concentrations as a diagnostic marker of the PFAPA syndrome

PFAPA syndrome is a clinical entity of unknown etiology characterized by periodic episodes of high fever accompanied by aphthous stomatitis, pharyngitis/tonsillitis, and cervical adenitis [3, 5]. Since specific laboratory abnormalities for the PFAPA syndrome are inexistent, it is usually diagnosed clinically after excluding other probable causes of the fever, such as infection [1]. In PFAPA patients, discriminating between a fever attack due to bacterial infection and a fever attack due to noninfectious inflammation constitutes a major difficulty. Because procalcitonin, a propeptide of calcitonin, is reported to be a sensitive marker of systemic bacterial infection [2, 4], we followed peripheral leukocyte counts, CRP values and procalcitonin concentrations during the fever attacks associated with PFAPA syndrome in the hope of defining reliable criteria for its diagnosis. We determined serum procalcitonin concentrations in six PFAPA syndrome patients (two males and four females) with a median age of 7.5 (range 3–10) years and in 32 controls (bacterial, n=10 and non-bacterial, n=22). Sampling was performed on the third to fifth day of fever. In the PFAPA syndrome patients, febrile episodes started at the median age of 2.5 (range 1–7) years with each episode lasting 5–7 days and recurring every 3–4 weeks. The ethical committees of our institutes approved the study protocol and the guardians of all the patients gave their informed consent. Serum procalcitonin concentrations were measured by using the fully automated enzyme immunoluminescent assay (Wako Pure Chemical Industries, Ltd.), which employs katacalcin monoclonal antibody and calcitonin polyclonal antibody labeled with peroxidase for SphereLight 180 (Olympus Corporation). The detection limit was 0.1 ng/ml and the normal reference was set at <0.5 ng/ml. In PFAPA patients, the correlations between procalcitonin, CRP values and leukocyte counts were examined over 13 febrile episodes. Serum procalcitonin values ranged from 0.20 to 11.36 (median value 1.05) ng/ml in positive control subjects (Table 1), while all the negative controls had undetectable levels. During febrile episodes in PFAPA patients, which were confirmed not to be due to adenoviral or group A streptococcal infections, leukocyte counts and serum concentrations of CRP were invariably and significantly Eur J Pediatr (2007) 166:621–622 DOI 10.1007/s00431-006-0281-2

Significance of elevation in cell-derived microparticles after allogeneic stem cell transplantation: transient elevation of platelet-derived microparticles in TMA/TTP.

Although stem cell transplantation (SCT) is being used for hematopoietic reconstitution following high-dose chemotherapy for malignancy, it involves some serious transplant-related complications.1 For example, graft-versus-host disease (GVHD), and vascular disorders such as veno-occlusive disease (VOD), pulmonary vasculopathy, thrombotic microangiopathy (TMA) and capillary leak syndrome, are considered to be very important. In particular, TMA is a well-recognized disorder, and several factors contribute to the onset of this complication.2 In the case of SCT, patients generally receive granulocyte colony-stimulating factor (G-CSF) after chemotherapy. The administration of G-CSF can affect serum cytokine levels of these patients,3 resulting in the generation of procoagulant factors such as platelet-derived microparticles (PDMP).4 In addition, some cytokines, such as G-CSF, IL-6 and thrombopoietin, modulate platelet activation.5 When TMA is described in patients who have undergone allogeneic SCT, it is often implied that the clinical diagnosis of TMA is similar to that of thrombotic thrombocytopenic purpura (TTP). However, TMA exhibits no symptoms at the initial stage in most cases. If it advances to a further progressive stage, a TTP-like symptom occurs. And the decrease of vWF-CPase activity is hardly recognized in TTP after bone marrow transplantation. PDMPs have been associated with TTP, and endothelial cells and monocytes can develop the same microparticles. We measured and compared the levels of microparticles and soluble factors in patients undergoing allogeneic SCT.

First description of somatic mosaicism in MYH9 disorders.

MYH9 disorders are characterized by giant platelets, thrombocytopenia, and Döhle body‐like cytoplasmic granulocyte inclusion bodies that result from mutations in MYH9, which encodes non‐muscle myosin heavy chain‐A (NMMHCA). These disorders are known to be transmitted in an autosomal dominant manner, although about 20% of cases are considered to be sporadic. We report here the first case of a MYH9 disorder because of somatic mosaicism. The patient was the father of a male with typical May–Hegglin anomaly. The father had normal platelet counts, however, both normal‐sized and giant platelets were observed on his peripheral blood smears. In addition, 14% of neutrophils contained inclusion bodies and the rest showed a normal morphology. Quantitative fluorescent polymerase chain reaction analysis showed that only 6% of DNA from peripheral blood leucocytes harboured the mutation. The mosaicism was demonstrated at a similar rate in different tissues, buccal mucosa cells and hair bulb cells, implying that the mutation had occurred before gastrulation. Mosaicism might account for some de novo mutations in MYH9 disorders.

Quantitative detection of serum adenovirus in a transplant recipient

Sir—Adenovirus infection in compromised hosts can become a fatal infection. This disorder, especially adenovirus-triggered severe haemorrhagic cystitis and systemic disease, is one of the most troublesome complications in transplant recipients, and has high morbidity. Serotypes 11, 34, and 35 are most common. We have established a real-time PCR system following the previously described procedure for adenovirus serotype 35. The PCR uses primers upstream 5 -CAGGTAGACTGCCT CGATGATG-3 , downstream 5 -GC CCACCCTGCTTTATCTTCTC-3 , and with a probe of 5 -(FAM)TGCA CTCTGACCACGTCGAAAACTTC (TAMRA)-3 cutoff 50 copies/mL in sera and 50 copies/ g creatinine in urine). We monitored serum and urine adenovirus genome quantitatively, although retrospectively, in one transplant recipient with severe adenovirus systemic disease. The viral genome load well reflected the disease activity. A girl aged 10 years with acute myeloblastic leukaemia (FAB, M3) underwent bone-marrow transplantation from a matched sibling donor after haematological relapse, with busulfan, cyclophosphamide, and melphalan conditioning, and with prophylaxis for graft-versus-host disease of cyclosporin A, methotrexate, and prednisolone. The transplant was successful, but the patient developed haemorrhagic cystitis starting at day 25, followed by severe systemic infection with high fever. We isolated adenovirus serotype 35 from her urine on day 26. Our PCR system showed that samples before transplantation were negative. Serum adenovirus genome became detectable on day 15 with around 75 10 copies/mL. As shown in the figure, serum adenovirus genome increased up to 2·5 10 copies/mL on day 60. Mild decrease of adenovirus genome might have reflected the treatment effect of intravenous vidarabin and ribavirin. Because of bone marrow failure, probably due to systemic adenovirus infection and adverse effect of antiviral treatment, a second bone-marrow transplant from the same donor was done on day 110. Even after the second transplantation, serum adenovirus genome remained high at 5 10 copies/mL, clinically associated with persistent fever and microhaematuria. With intensive care, the patient survived with late sequelae of renal and cardiac dysfunction. The adenovirus genome in urine was similarly changed as those in sera (figure). The detection of serum genome by PCR could be the first step towards predicting the outlook in transplant recipients with adenovirus infection. We suggest that real-time PCR is also useful for assessment of treatment response, as shown in post-transplant Epstein-Barr virus infection.

Long-term survival after HLA-haploidentical SCT from noninherited maternal antigen-mismatched family donors: impact of chronic GVHD.

Long-term survival after HLA-haploidentical SCT from noninherited maternal antigen-mismatched family donors: impact of chronic GVHD

Allogeneic stem cell transplantation in children with acute lymphoblastic leukemia after isolated central nervous system relapse: our experiences and review of the literature

The prognosis of patients with acute lymphoblastic leukemia (ALL) and central nervous system (CNS) relapse has historically been very poor. Although chemo-radiotherapy has improved outcomes, some patients still have a poor prognosis after CNS relapse. Therefore, allogeneic hematopoietic stem cell transplantation (allo-SCT) has recently become an option for treatment of CNS leukemia; however, information, particularly on the long-term outcome of transplant recipients, is limited. We performed allo-SCT in eight pediatric patients with ALL (n=7) or T-cell type non-Hodgkins lymphoma (n=1), who had isolated CNS relapse. All patients survived for a median of 70.5 (range, 13–153) months after SCT. Sequelae developed late in some patients: mental retardation (IQ=47) in one patient, severe alopecia in two patients, limited chronic graft-versus-host-disease in three patients, and amenorrhea and/or hypothyroidism in three patients. Except for a pre-school child with post transplant CNS relapse, six out of seven patients show normal school/social performance. Our results clearly indicate a high cure rate of isolated CNS relapse by allo-SCT in pediatric lymphoid malignancies; however, there needs to be further studies to determine which are the appropriate candidates for transplantation and what is the best transplant regimen to achieve high cure rate and maintain good quality of life.