Yaw-Don Hsu

Molecular modulation of expression of prion protein by heat shock

Prion diseases (also known as transmissible spongiform encephalopathies) are associated with the conversion of the normal cellular form of the prion protein (PrPC) to an abnormal scrapie-isoform (PrPSc. The conversion of PrPC to PrPSc is post-translational and is owing to protein conformational change. This has led to the hypothesis that molecular chaperones may be involved in the folding of prion proteins, and hence the disease process. By treating human NT-2 cells with heat-shock stress, we found that both the mRNA levels for prion protein (PrP) and heat shock protein 70 (HSP7O) increased simultaneously after heat treatment. Western-blot analysis of PrP also showed a two-fold increase in PrP protein level 3 after heat treatment. Furthermore, two heat-shock elements (HSEs) were located at the positions of −680 bp (HSE1; GGAACTATTCTTGACATTGCT), and −1653 bp (HSE2; TGAGAACTCAGGAAG) of the rat PrP (RaPrP) gene promoter. Luciferase reporter constructs of the RaPrP promoter with HSE expressed higher luciferase activity (10- to 15-fold) than those constructs without HSE. Electrophoretic gel mobility shift assay (EMSA) and super-shift assay confirmed the interaction of HSE1 and HSE2 with the heat-shock transcription factor-1 (HSTF-1). These results suggest that cellular stress up-regulates both the transcription and translation of PrP through interaction with the HSEs on the PrP gene promoter, resulting in an increase in protein synthesis.

Heat shock modulates prion protein expression in human NT-2 cells

The pathological hallmarks of Prion disease are cortical spongi-form changes and neuronal loss, which are induced by the accumulation of the scrapie-isoform prion protein (PrPSc). PrPSc is derived from a post-translational modification of the cellular form of prion protein (PrPC). Heat-shock proteins, a group of molecular chaperones, are involved in the degradation of denatured proteins and post-translational folding of newly synthesized polypeptides. In an attempt to examine any possible relationship between heat shock stress and an induction of prion protein (PrP), human NT-2 cells were treated with heat shock at 42°C for 30 min. After heat-shock treatment, both the level of mRNA and PrPC protein were analyzed at various time points by Northern and Western blot, respectively. There was a 1.5-to 2.5-fold increase in PrP mRNA levels 1 and 3 h following heat shock. In addition, a two-fold increase in protein level of PrP was found 3 h after heat-shock treatment. These results suggest that cellular stress induces the elevation of both PrP mRNA and protein synthesis. The up-regulation of prion-protein mRNA and protein, implies that PrP may play a role in cellular stress.

Skeletal Muscle Dihydropyridine-Sensitive Calcium Channel (CACNA1S) Gene Mutations in Chinese Patients with Hypokalemic Periodic Paralysis

Background:Thyrotoxic periodic paralysis (TPP), familial periodic paralysis (FPP), and sporadic periodic paralysis (SPP) are common causes of hypokalemic periodic paralysis and have similar clinical presentations, thus possibly sharing the identical mutations. Methods:We analyzed the role of the three known CACNA1S gene mutations (R528H, R1239H, and R1239G) in Chinese patients, including two FPP families, 36 TPP patients, 12 SPP patients, and their relatives. Fifty unrelated healthy subjects were also studied. Genomic DNA was prepared from the peripheral blood of all patients, their family members, and healthy subjects. Mutations of the CACNA1S gene were screened using polymerase chain reaction–based restriction analysis. Results:Two FPP families had the R528H point mutation, but with incomplete penetrance occurring more commonly in men than in women. Only one SPP patient had a de novo mutation (R528H). None of the TPP patients had mutations in the three hot spots. Conclusion:Patients with FPP have R528H mutations in the CACNA1S gene. Only a few patients with SPP may share similar mutations with FPP. TPP patients do not carry any of the three known gene mutations.

Panencephalitic Creutzfeldt-Jakob disease in a Chinese family. Unusual presentation with PrP codon 210 mutation and identification by PCR-SSCP

A point mutation at codon 210 (GTT to ATT) of the prion protein gene on chromosome 20 was found in a 48-year-old CJD-affected woman of a Chinese family. This affected woman had an early onset and long-duration form of CJD. Serial magnetic resonance image (MRI) analysis of this woman showed severe brain atrophy, prominent diffuse white matter degeneration, and subsequent mineralization of basal ganglia and thalamus. MR spectroscopy (1H) analysis elucidated the absence of peaks of choline, creatine and N-acetylaspartate. Using polymerase chain reaction and single-strand conformational polymorphism (PCR-SSCP) techniques, presymptomatic diagnosis of the second son of this woman showed that he has a similar codon mutation of prion gene as his mother.

Vascular dementia of Binswanger's type: clinical, neuroradiological and99mTc-HMPAO SPET study

In 24 patients with vascular dementia of Binswangers type (VDBT) and 14 age-matched neurologically normal volunteers, we investigated the relationship between clinical features, white matter lesions (leucoaraiosis) and cerebral atrophy on computed tomography (CT) scan, and regional cerebral blood flow. All subjects underwent the Mini-Mental State Examination of Taiwan, version 1 (MMSE-T1), for assessing the severity of cognitive impairment. The patients were subdivided into two groups, one with mild to moderate (group I, MMSE-T1 scores: 11–24,n=ll), and the other with severe dementia (group II, MMSE-T1 scores: below 10,n=13). White matter degeneration was evaluated with densitometric methods. Loss of brain parenchyma was estimated with seven linear measurements (Evans ratio, third ventricle ratio, width of temporal horn tip, anterior-posterior length of temporal horn, anterior-posterior length of Sylvian fissure and width of frontal interhemispheric fissure) by CT scans. Regional cerebral blood flow was determined with technetium-99m hexamethylpropylene amine oxime (HMPAO) single-photon emission tomography (SPET). In neuroimaging studies, subcortical leuco-araiosis was localized at the frontal region in group I patients and scattered diffusely in group II patients.99mTc-HMPAO SPET analysis revealed reduction of regional cerebral blood flow in the frontal lobe in group I patients and widespread reduction of regional cerebral blood flow in group II patients. A correlation between frontal leuco-araiosis and perfusion defect of the frontal pole was demonstrated in group I patients, showing findings typical of subcortical dementia. There was no difference in frontal atrophic measurements between group I patients and controls. Ratios of volumes of lost brain parenchyma and leuco-araiosis were significantly higher in group II patients than in the age-matched controls, corresponding to a diffuse cerebral perfusion defect. These results suggest that patients with VDBT have early frontal lobe involvement with posterior progression. Patients with mild VDBT are more likely to show reduction of frontal cerebral blood flow and leuco-araiosis, while those with severe VDBT are more likely to have diffuse leuco-araiosis, cerebral hypoperfusion and brain atrophy.

Increased Risk of Cerebral Hemorrhage in Chinese Male Heavy Drinkers with Mild Liver Disorder

Background: Epidemiological evidence suggests that heavy alcohol consumption increases the risk for either stroke or liver disease. The goal of this study was to determine whether heavy drinkers with mild liver disorder (MLD) are at risk of hemorrhagic stroke. Methods:All of the 524 patients recruited were males with a first-ever acute stroke and were consecutively admitted to the Tri-Service General Hospital between January 2000 and December 2001. The risk factors, liver function, stroke subtypes, and hemostatic factors were assessed among 68 patients defined as heavy drinker stroke (HDS) and 456 patients as nonheavy drinker stroke (NHDS). Results: HDS patients had a significantly higher incidence of hemorrhagic stroke than NHDS patients. HDS patients were also associated with significantly higher occurrence of cigarette smoking, hyperuricemia, liver dysfunction, and significantly lower platelet counts. HDS patients with MLD were more likely to have hemorrhagic stroke (76.5%) than HDS patients without MLD (33.3%) and NHDS patients with (40.3%) or without (26.7%) MLD. HDS patients with MLD also exhibited a significantly higher glutamic oxaloacetic transaminase/glutamic pyruvic transaminase ratio (2.0 ± 1.2) and lower platelet number (185,000 ± 85,000 per µl) when compared with HDS patients without MLD (1.4 ± 0.5; 206,000 ± 59,000 per µl) and NHDS patients with (1.1 ± 1.0; 256,000 ± 97,000 per µl) or without (1.4 ± 0.7; 216,000 ± 68,000 per µl) MLD. Conclusions: HDS patients with MLD are at higher risk for hemorrhagic stroke in part due to the changes in hemostatic factors, although other factors may also contribute to hemorrhagic stroke.

Application of chromosome 4q35-qter marker (pFR-1) for DNA rearrangement of facioscapulohumeral muscular dystrophy patients in Taiwan

Facioscapulohumeral muscular dystrophy (FSHD) has been found to be linked to chromosome 4qter. A chromosome 4q35-ter marker, pFR-1 (subclone of the cosmid c51), has been recently isolated and used as a probe for mapping near, or within, the FSHD gene. To examine FSHD-associated DNA rearrangements in the Taiwan population, we used the pFR-1 probe to perform Southern blot analysis on 142 individuals, including 32 FSHD patients within 9 autosomal dominant families, five sporadic FSHD patients from 4 families (include one pair of twins), three sporadic scapuloperoneal syndrome (SPS) patients and two sporadic polymyositis patients with their unaffected parents, and 29 healthy controls. In 29 healthy individuals, 3 SPS and 2 polymyositis patients with their families, probe pFR-1 analysis revealed that all had polymorphic restriction fragments that were larger than 28 kb in length. All but 1 FSHD-affected individual had specific smaller EcoRI fragments (ranging in size from 10.5 to 27 kb). Two point linkage analysis between pFR-1 and the FSHD locus provided significant evidence for FSHD linkage (Z(max)=6.84). A similar smaller fragment was also present in 5 sporadic patients, while this smaller fragment could not be found in one of their parents. Identical EcoRI restriction fragment length polymorphism (RFLP) patterns linked to FSHD were shown in the monozygotic twins, even though they showed extreme variability in the expression of FSHD. We conclude that the pFR-1 probe is a tightly linked marker of FSHD and can be used to detect most DNA rearrangements associated with this disease in the Taiwan population. However, the same RFLP patterns may represent extreme variability in the expression of the FSHD gene.

Creutzfeldt-Jakob disease: heat shock protein 70 mRNA levels in mononuclear blood cells and clinical study

Abstract Prion diseases such as Creutzfeldt-Jakob disease (CJD) are associated in most cases with the accumulation of an unusual isoform of prion protein (PrPSC). PrPSC is derieved from the abnormal folding of the cellular isoform of prion protein (PrPC). On the other hand, heat shock protein is known to ensure proper protein assembly and folding and to facilitate proteolytic digestion of abnormal or denatured proteins. Many studies have therefore hypothesized that heat shock protein is linked to prion disease. We examined the relationship between heat shock protein HSP70 and prion disease in CJD patients. HSP70 mRNA levels in mononuclear blood cells (MBCs) were compared in 14 CJD patients (10 confirmed by histo-pathological study), 12 vascular dementia (VD) patients, 16 patients with Parkinsons disease and dementia (PD) and 14 nondemented control subjects. The possible correlation between HSP70 mRNA expression levels and clinical findings was also evaluated. HSP70 mRNA expression levels in MBCs were measured by northern blotting. HSP70 mRNA levels in MBCs from patients with CJD were significantly higher than those from patients with VD or PD and in nondemented controls. Age at symptom onset, dementia severity, disease duration and neuroimaging grade of CJD patients were not correlated with relative HSP70 mRNA levels. No significant relationship between HSP70 mRNA levels and aging was found. These results suggest that measurement of HSP70 mRNA in MBCs might provide an auxiliary tool for the diagnosis of CJD.

Homocysteine induces cerebral endothelial cell death by activating the acid sphingomyelinase ceramide pathway.

Homocysteine (Hcy) levels may rise after a stroke, but the mechanism of Hcy-induced cerebral endothelial cell (CEC) dysfunction has not been explored. In this study we examined the role of the acid sphingomyelinase (Asm)-ceramide pathway in the molecular mechanism of Hcy-induced CEC dysfunction. Murine CECs were prepared from fresh mouse brains. CECs were treated with 50-500 μM Hcy and 30-100 μM C2-ceramide for 48 h. Sphingomyelinase assays were performed to determine Asm activity. Quantitative assessments of cell survival and death by the MTT reduction and LDH release were conducted. Treatment of murine CECs with Hcy and ceramide caused cell death in a dose-dependent manner as determined by LDH and MTT assays. 250 μM Hcy and 50 μM C2-ceramide caused 50% cell death. Hcy induced murine CEC death also occurred in a time-dependant manner with substantial cell death noted as early as 24h after Hcy exposure. C2-ceramide-induced murine CEC death occurred earlier than Hcy-induced cell death by about 18h. Hcy treatment increased Asm activity and intracellular ceramide accumulation. This study demonstrated that Hcy and C2-ceramide can cause murine CEC death. Hcy induces CEC death possibly by activating the Asm-ceramide pathway.

Risk Factor Stratification for Intracranial Stenosis in Taiwanese Patients With Cervicocerebral Stenosis

Background Intracranial stenosis (ICS) is a major determinant of ischemic stroke in Asians. We determined the clinical significance of different risk factors and the role of ICS in Taiwanese patients with varied distributions of cervicocerebral stenosis. Methods and Results Presence of extracranial carotid stenosis (ECS, ≥70%) and ICS (>50%) was examined in 13 539 patients using ultrasonography and magnetic resonance angiography, respectively. Seven hundred thirty‐three patients with non‐ECS/ICS (n=372), isolated ICS (n=112), isolated ECS (n=121), or combined ECS/ICS (CEIS, n=128) were selected. Prevalence of ischemic stroke in each group was compared, and risk factors for stenosis were determined. The area under the receiver operating characteristic curve for each risk factor was calculated. Prevalence of ischemic stroke was highest in patients with CEIS (odds ratio 15.86; P<0.001), followed in decreasing order by those with isolated ICS (odds ratio 7.16; P<0.001), isolated ECS (odds ratio 1.77; P=0.011), and non‐ECS/ICS. Multivariate logistic regression analysis revealed that hypertension, coronary artery disease, and smoking were risk factors for isolated ECS; hypertension, diabetes mellitus, coronary artery disease, and smoking were risk factors for isolated ICS; and diabetes mellitus, coronary artery disease, and smoking were risk factors for CEIS. Smoking, diabetes mellitus, and coronary artery disease were the greatest contributors to CEIS, isolated ICS, and isolated ECS, respectively. Conclusions CEIS was associated with higher odds of ischemic stroke compared with isolated ICS and isolated ECS. Smoking and diabetes mellitus, major determinants of CEIS and isolated ICS, should be targeted in therapeutic strategies to reduce the risk of ischemic stroke.