Yoko Noguchi

Early death of mice cloned from somatic cells.

Here we report that the lifespan of mice cloned from somatic cells is significantly shorter than that of genotype- and sex-matched controls, most likely due to severe pneumonia and hepatic failure. This finding demonstrates the possibility of long-term deleterious effects of somatic-cell cloning, even after normal birth.

BETA -GALACTOSIDASE-DEFICIENT MOUSE AS AN ANIMAL MODEL FOR GM1-GANGLIOSIDOSIS

GM1-gangliosidosis is a progressive neurological disease in humans caused by deficiency of lysosomal acid β-galactosidase, which hydrolyses the terminal β-galactosidic residue from ganglioside GM1 and other glycoconjugates. In this study, we generated a mouse model for GM1-gangliosidosis by gene targeting in embryonic stem cells. The mouse homozygous for the disrupted β-galactosidase gene showed β-galactosidase deficiency, presented with progressive spastic diplegia, and died of emaciation at 7–10 months of age. Pathologically, PAS-positive intracytoplasmic storage was observed in neuronal cells of various areas in the brain. Biochemical analysis revealed a marked accumulation of ganglioside GM1 and asialo GM1 in brain tissue. This animal model will be useful for pathogenetic analysis and therapeutic trial of human GM1-gangliosidosis.

Chemical chaperone therapy: clinical effect in murine GM1‐gangliosidosis

Certain low‐molecular‐weight substrate analogs act both as in vitro competitive inhibitors of lysosomal hydrolases and as intracellular enhancers (chemical chaperones) by stabilization of mutant proteins. In this study, we performed oral administration of a chaperone compound N‐octyl‐4‐epi‐β‐valienamine to GM1‐gangliosidosis model mice expressing R201C mutant human β‐galactosidase. A newly developed neurological scoring system was used for clinical assessment. N‐Octyl‐4‐epi‐β‐valienamine was delivered rapidly to the brain, increased β‐galactosidase activity, decreased ganglioside GM1, and prevented neurological deterioration within a few months. No adverse effect was observed during this experiment. N‐Octyl‐4‐epi‐β‐valienamine will be useful for chemical chaperone therapy of human GM1‐gangliosidosis. Ann Neurol 2007

Hereditary nephrotic syndrome with progression to renal failure in a mouse model (ICGN strain): clinical study.

The clinical course of murine hereditary nephrotic syndrome (ICGN strain) was determined by examining 201 animals under different conditions. In the early stage, significant hypoproteinemia and hypoalbuminemia developed (p < 0.001) in parallel with a progressive rise in urinary protein concentration (p < 0.001). In the middle stage, the concentrations of total cholesterol, triglyceride, and beta-lipoprotein markedly increased (p < 0.01, p < 0.001, and p < 0.001, respectively), suggesting that type IIb hyperlipoproteinemia developed as in human nephrotic patients. Systemic edema appeared in 8 of 24 animals. In the terminal stage, both BUN and creatinine values greatly increased (p < 0.001), indicating rapid deterioration of renal function. The present study suggests that ICGN mice could be a useful model to study the pathophysiology of human nephrotic syndrome and its progression to renal failure.

Improved postimplantation development of rabbit nuclear transfer embryos by activation with inositol 1,4,5-trisphosphate.

Cloned rabbit embryos are characterized by their extremely poor postimplantation development, despite their high survivability until the blastocyst stage in vitro. This study examined whether the developmental failure of cloned rabbit embryos in vivo can be overcome by technical improvements to the activation protocol. Freshly collected cumulus cells were transferred into enucleated oocytes by intracytoplasmic injection. One to two hours later, the oocytes were activated by electroporation with Ca(2+) or inositol 1,4,5-trisphosphate (IP3), which is known to induce repeated rises in intracellular Ca(2+), as in normal fertilization. After transfer of embryos at the two- to four-cell stages, well-defined implantation sites with remnant fetal tissue were observed at term (day 28) only in the IP3-stimulation groups (0.9% and 5.8% per transferred embryo for single and triple stimulation groups, respectively). When some recipients in the same group were examined at days 16-20, a viable cloned fetus (day 19) with normal organogenesis was obtained. These findings clearly demonstrate that the oocyte activation protocol using IP3 enhances the postimplantation development of nuclear-transferred rabbit embryos.

Increased globotriaosylceramide levels in a transgenic mouse expressing human α1,4-galactosyltransferase and a mouse model for treating Fabry disease

Fabry disease is a lysosomal storage disorder caused by an α-galactosidase A (α-Gal A) deficiency and resulting in the accumulation of glycosphingolipids, predominantly globotriaosylceramide (Gb3). A transgenic mouse expressing the human α-Gal A R301Q mutant in an α-Gal A-knockout background (TgM/KO) should be useful for studying active-site-specific chaperone (ASSC) therapy for Fabry disease. However, the Gb3 content in the heart tissue of this mouse was too low to detect an ASSC-induced effect. To increase the Gb3 levels in mouse organs, we created transgenic mice (TgG3S) expressing human α1,4-galactosyltransferase (Gb3 synthase). High levels of Gb3 were observed in all major organs of the TgG3S mouse. A TgG3S (+/-)M(+/-)/KO mouse was prepared by cross-breeding the TgG3S and TgM/KO mice and the Gb3 content in the heart of the TgG3S(+/-)M(+/-)/KO mouse was 1.4 µg/mg protein, higher than in the TgM(+/-)/KO (<0.1 µg/mg protein). Treatment with an ASSC, 1-deoxygalactonojirimycin, caused a marked induction of α-Gal A activity and a concomitant reduction of the Gb3 content in the TgG3S(+/-) M(+/-)/KO mouse organs. These data indicated that the TgG3S(+/-) M(+/-)/KO mouse was suitable for studying ASSC therapy for Fabry disease, and that the TgG3S mouse would be useful for studying the effect of high Gb3 levels in mouse organs.

Adult onset cardiac dilatation in a transgenic mouse line with Galβ1,3GalNAc α2,3-sialyltransferase II (ST3Gal-II) transgenes: a new model for dilated cardiomyopathy

Sugar chain abnormalities in glycolipids and glycoproteins are associated with various diseases. Here, we report an adult onset cardiac dilatation in a transgenic mouse line with Galβ1,3GalNAc α2,3-sialyltransferase II (ST3Gal-II) transgenes. The transgenic hearts at the end-stage, at around 7 months old, were enlarged, with enlarged cavities and thin, low-tensile walls, typical of dilated cardiomyopathy. Although no apparent change was found in heart gangliosides, glycosylation of heart proteins was altered. Interestingly, sugar moieties not directly related to the ST3Gal-II catalytic reaction were also changed. Significant increases in calreticulin and calnexin were observed in hearts of the transgenic mice. These results suggest that expression of ST3Gal-II transgenes induces abnormal protein glycosylation, which disorganizes the endoplasmic/sarcoplasmic reticulum quality control system and elevates the calreticulin/calnexin level, resulting in suppression of cardiac function. The transgenic mice showed 100% incidence of adult onset cardiac dilatation, suggesting great potential as a new model for dilated cardiomyopathy.

Localization of HIV-1 in human thymic implant in SCID-hu mice after intravenous inoculation

Human immunodeficiency virus type 1 (HIV‐1) was immunohistochemically and ultrastructurally localized in human thymus implants in SCID‐hu mice 3 weeks after intravenous (i.v.) inoculation of the virus. A viral antigen (gp120) was predominantly distributed in and around the epithelial cells in Hassall’s corpuscles as demonstrated by fluorescence immunohistochemistry. Occasional solitary round cells positive for the viral antigen but negative for cytokeratin were detected in the perivascular areas. Ultrastructural examinations clearly revealed a number of mature viral particles in the intercellular spaces of the Hassalls corpuscles. Thus the present study indicates the possibility that thymic epithelial cells in Hassalls corpuscles act as a target and/or reservoir in an early stage of HIV infection.

Zygosity Determination in Hairless Mice by PCR Based on Hr hr Gene Analysis

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hrhr allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hrhr in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hrhr allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hrhr (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hrhr gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.

Ourrccence of Sick Animals in Conventional Guinea Pigs Obtained from Commercial Breeders during 1964 to 1982

A quarantine was performed on conventional Hartley guinea pigs free from Streptococcus zooepidemicus, Bordetella bronchiseptica and Salmonella spp., but infected with Eimeria caviae, which were purchased from twenty-five commercial breeders by the National Institute of Health. Physical examinations revealed an incidence of 0.88 per cent or 1,461 sick animals in 166, 050 guinea pigs quarantined during the period 1964 to 1982. The result obtained showed the following significant differences between the periods 1964 to 1971 and 1972 to 1982: Annual incidence of sick animals in the period 1972 to 1982 increased twice as many as 0.56 to 0.81 per cent during the 1964 to 1971, and monthly incidence showed bimodal occurrence at April and October in the former period but continual occurrence from November to April in the latter period. Major clinical signs in the former period were death and diarrhea, which occurred usually within a week after arrival of the guinea pigs at our institute and caused significant decrease of body weight, but those in the latter period were retarded growth and weakness which became detectable during 1-3 weeks after arrival of the animals. Discussions were made on possible reasons concerning the differences in incidence of sick animals during the two periods.