Aarón Domínguez-López

The FTO gene is associated with adulthood obesity in the Mexican population.

Common polymorphisms in the fat mass and obesity‐associated gene (FTO) have shown strong association with obesity in several populations. In the present study, we explored the association of FTO gene polymorphisms with obesity and other biochemical parameters in the Mexican population. We also assessed FTO gene expression levels in adipose tissue of obese and nonobese individuals. The study comprised 788 unrelated Mexican‐Mestizo individuals and 31 subcutaneous fat tissue biopsies from lean and obese women. FTO single‐nucleotide polymorphisms (SNPs) rs9939609, rs1421085, and rs17817449 were associated with obesity, particularly with class III obesity, under both additive and dominant models (P = 0.0000004 and 0.000008, respectively). These associations remained significant after adjusting for admixture (P = 0.000003 and 0.00009, respectively). Moreover, risk alleles showed a nominal association with lower insulin levels and homeostasis model assessment of B‐cell function (HOMA‐B), and with higher homeostasis model assessment of insulin sensitivity (HOMA‐S) only in nonobese individuals (P dom = 0.031, 0.023, and 0.049, respectively). FTO mRNA levels were significantly higher in subcutaneous fat tissue of class III obese individuals than in lean individuals (P = 0.043). Risk alleles were significantly associated with higher FTO expression in the class III obesity group (P = 0.047). In conclusion, FTO is a major risk factor for obesity (particularly class III) in the Mexican‐Mestizo population, and is upregulated in subcutaneous fat tissue of obese individuals.

Transcript levels of Toll-Like receptors 5, 8 and 9 correlate with inflammatory activity in Ulcerative Colitis

BackgroundDysregulation of innate immune response by Toll-Like Receptors (TLRs) is a key feature in Ulcerative Colitis (UC). Most studies have focused on TLR2, TLR3, and TLR4 participation in UC. However, few studies have explored other TLRs. Therefore, the aim of this study was to evaluate the mRNA profiles of TLR1 to 9 in colonic mucosa of UC patients, according to disease activity.MethodsColonic biopsies were taken from colon during colonoscopy in 51 patients with Ulcerative Colitis and 36 healthy controls. mRNA levels of TLR1 to 9, Tollip, inflammatory cytokines IL6 and TNF were assessed by RT-qPCR with hydrolysis probes. Characterization of TLR9 protein expression was performed by Immunohistochemistry.ResultsToll-like receptors TLR8, TLR9, and IL6 mRNA levels were significantly higher in the colonic mucosa from UC patients (both quiescent and active) as compared to healthy individuals (p < 0.04). In the UC patients group the TLR2, TLR4, TLR8 and TLR9 mRNA levels were found to be significantly lower in patients with quiescent disease, as compared to those with active disease (p < 0.05), whereas TLR5 showed a trend (p = 0.06). IL6 and TNF mRNA levels were significantly higher in the presence of active disease and help to discriminate between quiescent and active disease (p < 0.05). Also, IL6 and TNF mRNA positively correlate with TLRs mRNA with the exception for TLR3, with stronger correlations for TLR5, TLR8, and TLR9 (p < 0.0001). TLR9 protein expression was mainly in the lamina propria infiltrate.ConclusionsThis study demonstrates that TLR2, TLR4, TLR8, and TLR9 expression increases in active UC patients, and that the mRNA levels positively correlate with the severity of intestinal inflammation as well as with inflammatory cytokines.

Colonic epithelial upregulation of interleukin 22 (IL-22) in patients with ulcerative colitis.

To the Editor: Inflammatory bowel disease (IBD) is a chronic inflammatory disease thought to be mediated by dysfunctional innate and/or adaptive immunity. This aberrant immune response leads to the secretion of harmful cytokines that destroy the epithelium of the gastrointestinal tract and thus cause further inflammation. Interleukin (IL)-22, a member of the IL-10 subfamily, is a recently identified T-cell-derived cytokine. Expression of IL-22 is induced in several human inflammatory conditions, including IBD. A recent article published by Sugimoto et al found that IL-22 gene delivery led to rapid amelioration of local intestinal inflammation in a dextran sulfate sodium-induced model of acute colitis. Expression of the IL-22 receptor is restricted to innate immune cells; however, the role of IL22 in ulcerative colitis (UC) patients has not yet been defined. This is the first study to our best knowledge with a larger sample that explores IL-22 gene expression from rectal biopsies in patients with UC. We measured the IL22 gene expression from rectum biopsies of UC patients from September 2008 to September 2009. All individuals were divided in 3 groups: 1) active UC (n 1⁄4 26); 2) long-term UC remission (n 1⁄4 11); and 3) a healthy control group (n 1⁄4 18). Expression of mRNA IL-22 was measured with a real-time polymerase chain reaction (RT-PCR) method. The following primers were used: IL-22 forward: ccctcaatctgataggttccag and reverse: gcaggtcatcaccttcaatatg; GADPH forward: gcccaatac gaccaaatcc and reverse: agccacatcgctcagaca for normalization. These results showed that IL-22 mRNA expression was upregulated in rectal mucosa from patients with active UC compared to UC patients in remission and healthy controls (P < 0.04 and P < 0.0001, respectively). Interestingly, the expression of IL-22 was also significantly increased in remission UC as compared to normal controls (P < 0.01) as shown in Figure 1. We also found that IL-22 gene expression correlated with histological activity (r 1⁄4 0.63 P < 0.0007) by Spearman correlation test. These findings confirmed the potential role of the IL-22 gene in the pathogenesis of UC and suggests that IL-22 might be involved as a defense mechanism by enhanced mucus production. In conclusion, gene expression of IL-22 was found to be increased from rectal biopsies in patients with UC.

Association of the I148M/PNPLA3 variant with elevated alanine transaminase levels in normal-weight and overweight/obese Mexican children

BACKGROUND AND AIMS Non-alcoholic fatty liver disease (NAFLD) and elevated alanine transaminase (ALT) levels are common in obese Hispanic adults and children. Recently, a PNPLA3 gene variant (I148M) was strongly associated with NAFLD and higher ALT levels in obese adults, including Hispanics. The aims of this study were to estimate the frequency of elevated ALT levels, and to address the influence of obesity and PNPLA3/I148M on ALT levels in a general population sample of Mexican school-aged children. METHODS A total of 1037 non-related Mexican children aged 6 to 12 years were genotyped for the I148M variant. Anthropometric, clinical and metabolic parameters were collected from all participants. RESULTS Elevated ALT levels (>35 U/L) were more frequent in obese (26.9%) and overweight (9.3%) than in normal weight children (2.2%). The M148M genotype was significantly associated with elevated ALT levels in this population (OR=3.7, 95% CI 2.3-5.9; P=3.7×10(-8)), and children carrying the M148M genotype showed significantly lower HDL cholesterol levels and BMI z-core (P=0.036 and 0.015, respectively). On stratifying by BMI percentile, this genotype conferred a much greater risk of elevated ALT levels in normal weight (OR=19.9, 95% CI 2.5-157.7; P=0.005) than overweight and obese children (OR=3.4, 95% CI 1.3-8.9; P=0.014 and OR=3.1, 95% CI 1.7-5.5; P=1.4 x10(-4), respectively). CONCLUSIONS The I148M PNPLA3 variant is strongly associated with elevated ALT levels in normal weight and overweight/obese Mexican children. Thus, the M148M genotype may be considered as an important risk factor for liver damage in this population.

TLR9 mRNA expression is upregulated in patients with active ulcerative colitis

To the Editor: TLR9 is a member of the innate immunity Toll-like receptors (TLRs) family that recognizes bacterial unmethylated CpG DNA motifs. In experimental models of colitis, activation of TLR9 with artificial CpG ODN has proven beneficial. Also, TLR9 was reported to mediate interleukin 8 (IL8) production in colonic epithelial cell lines in response to DNA from pathogenic bacteria. Genetic studies have shown that polymorphisms in TLRs may participate in both Crohn’s disease (CD) and ulcerative colitis (UC). In particular, TLR9 ( 1237T/C) polymorphism has recently been implicated in the development of IBD. Recently, Ghadimi at al showed that TLR9 activation by commensal-origin bacteria DNA is important in the induction of IL-8 production. To our best knowledge, this is the first study designed to evaluate TLR9 gene expression from rectal biopsies in patients with UC. We quantified mRNA levels in rectal biopsy specimens from UC patients and healthy controls. Forty-nine rectal biopsies were obtained from a first cohort group that consisted of 38 UC patients (22 active and 16 remission) as well as 11 healthy controls. All individuals were assessed for TLR9 and IL-6 mRNA transcript levels relative to RPLP0 constitutive gene using real-time reverse-transcription polymerase chain reaction (RT-PCR) using LNA TaqMan probes from Roche (Nutley, NJ) in combination with target gene-specific primers (primer sequences: TLR9 50-TGTGAAGCATG GTTCCCTGT-30, 50-GAGAGACAGCG GGTGCAG-30, IL6 50-GCCCAGCTAT GAACTCCTTCT-30, 50-GAAGGCAGC AGGCAACAC-30 RPLP0 50-ACAGGG CGACCTGGAAGT-30, 50-GGATCTGC TGCATCTGCTT-30). In order to confirm these findings, we also studied a second cohort group that consisted of 36 UC patients (27 active, 9 remission) and 22 healthy controls. Both cohorts were also assessed for TLR9 and IL-6 mRNA relative to RPLP0 as previously described. All results were calibrated to the same control sample performed in all experiments in both cohorts. Also, to solve a possible bias from housekeeping selection both b-actin (50-CCAACCGC GAGAAGATGA-30, 50-CCAGAGGCG TACAGGGATAG-30) and GAPDH (50AGCCACATCGCTCAGACAC-30, 50-G CCCAATACGACCAAATCC-30) were also assessed in the second cohort group. Analysis of the whole sample showed that TLR9 mRNA levels were found significantly increased in the UC active group when compared with healthy controls and patients with UC in remission and healthy controls (Fig. 1A). A good correlation was found between TLR9 with IL6 (r 1⁄4 0.603 P < 0.001) (Fig. 1B). Results from the

Interleukin 21 Expression Is Increased in Rectal Biopsies from Patients with Ulcerative Colitis

To the Editor: Interleukin 21 (IL-21) is a T-cell derived cytokine member of the common gamma-chain-dependent cytokine family, which in general acts on intestinal epithelium helping to maintain the ongoing Th1 inflammation inducing the production of IFN-c. IL-21 also has shown to enhance the expansion of NK cells. IL-21 is expressed by immune T and B cells and nonimmune-like fibroblasts where it activates the metalloproteinase 1 production, signaling through its receptor IL-21R activates STAT-3 in T cells. IL-21, like IL-6 and IL-23, is also involved in Th17 cell differentiation and it is overexpressed in Crohn’s disease (CD). Genetic variants in the region harboring IL2/IL21 have been associated with the genetic susceptibility for developing ulcerative colitis (UC). A recent study has reported IL-21 receptor (IL-21R)-positive cells were significantly increased in inflamed mucosa of inflammatory bowel disease (IBD) patients compared with controls, and mainly expressed in freshly isolated peripheral blood (PB) and lamina propria (LP)-CD4(þ), CD8(þ) T, B, and NK cells. However, this is the first study to our best knowledge with a larger sample that explores the IL-21 gene expression from rectal biopsies in patients with UC. We measured the IL-21 gene expression from rectum biopsies of UC patients from September 2008 to July 2009. All individuals were divided into 3 groups: 1) active UC (n 1⁄4 21); 2) long-term UC remission (n 1⁄4 21); and 3) normal control group (n 1⁄4 20). Expression of mRNA IL-21 and IL-6 were measured by real time polymerase chain reaction (RT-PCR). The following primers were used: IL-21 forward: aggaaaccaccttccacaaa and reverse: gaatcacatgaagggcatgtt; GADPH forward: gcccaatac gaccaaatcc and reverse: agccacatcgctcagaca for normalization. These results showed that IL-21 mRNA expression was increased in rectal mucosa from patients with active UC compared to UC patients in remission and the healthy control group (P 1⁄4 0.025 and P 1⁄4 0.007, respectively). The IL-21 expression was similar in patients with UC in remission and the healthy control group (P 1⁄4 0.546), as shown in Figure 1. We also found that IL-21 gene expression correlated with histological activity (r 1⁄4 0.675, P 1⁄4 0.001) by Spearman correlation test. These findings confirmed the potential role of IL21 gene in the pathogenesis of UC and suggest that antibodies directed to IL21 could be used as a potential target for treating patients with IBD. In conclusion, high gene expression of IL-21 was found from rectal biopsies in patients with UC.

High gene expression of MDR1 (ABCB1) is associated with medical treatment response and long‐term remission in patients with ulcerative colitis

To the Editor: The multidrug resistant gene 1 (MDR1), also known as ABCB1, is the first member of the ATP binding cassette family (ABC) proteins. MDR1 is expressed in hepatocytes, enterocytes, brain blood capillaries, ovaries, and testes cells as well as peripheral blood mononuclear cells and macrophage. The relevance of MDR1 gene in inflammatory bowel disease (IBD) is based on data provided from Mdr1a / knockout mice that spontaneously develop colitis around 12 weeks of age. MDR1 expression in the intestinal tract has an important role in the pharmacokinetics of drugs used in ulcerative colitis (UC) treatment such as corticosteroids, which have been associated with drug resistance. Polymorphisms of the MDR1 gene have been associated with refractory Crohn’s disease (CD) and UC. A previous study has reported low expression of MDR1 in inflamed mucosa in patients with UC. However, this is the first study to the best of our knowledge with a larger sample that explores an association between MDR1 expression in biopsies from rectum and clinical outcomes such as medical treatment response and longterm remission in patients with UC. We measured the MDR1 gene expression from rectum biopsies of UC patients from December 2006 to July 2008. All individuals were divided into 3 groups: 1) active UC (n 1⁄4 21); 2) long-term UC remission (n 1⁄4 21); and 3) normal control group (n 1⁄4 20). Expression of mRNA MDR1 (ABCB1) and IL-6 were measured by real-time polymerase chain reaction (RT-PCR). The following primers were used: MDR1 forward: acagaaagcgaagcatggt and reverse: atggtggtccgaccttttc; IL-6 forward: tctgctcccacaatgaaacat and reverse: gatgcccagggaagacag, as well as RPLP0 forward: acagaaagcgaagcatggt, reverse: atggtggtccgaccttttc for normalization. Medical response was defined as induction and maintenance of remission with treatment based on mesalazine (3–4.5 g/day), or oral prednisone 0.5– 0.7 mg/kg/day and azathioprine 2–2.5 mg/kg/day. Long-term remission was the absence of activity by clinical, endoscopic, and histological criteria for at least 2 years according to Mayo and Riley scores, respectively. These results showed that MDR1 expression was decreased in patients with active UC compared to UC patients in remission and the normal control group (P 1⁄4 0.034 and P 1⁄4 0.002, respectively). The MDR1 levels were decreased in UC remission compared to the normal control group (P 1⁄4 0.04) (Fig. 1). The IL-6 gene expression was increased in patients with active UC compared to UC in remission and the normal control group (P 1⁄4 0.001). The medical treatment response and long-term remission were associated

Expression of HNF4γ is downregulated in patients with active ulcerative colitis (UC) compared to UC patients in remission and healthy controls.

To the Editor: The hepatocyte nuclear factor 4c (HNF4c) is a transcription factor with fatty acid ligands, belonging to the family of nuclear receptors. These receptors could modulate inflammation and embryonic formation of the colon. The HNF4 family has been associated with alterations in the integrity of intestinal epithelium and contributes in the pathogenesis of inflammatory bowel disease (IBD) because they act like transcription factors in chronic inflammatory processes. For this reason the HNF4c expression has been studied in inflammatory diseases of kidney, liver, pancreas, testes, small intestine, and colon. In patients with ulcerative colitis (UC) the HNF4c expression has been reported to be altered; however, it is not clear if the expression is increased or decreased and in animal models a high expression of HNF4c has been found that correlated with increased weight and decreased physical activity. The HNF4c gene can act as modulator of inflammation in patients with UC. This is the first study with a larger sample size that explores the role of the HNF4c gene in patients with active and remission UC compared to a healthy control group. We studied a total of 90 individuals who wore divided into three groups: 1) active UC (n 1⁄4 30); 2) remission UC (n 1⁄4 30); and 3) healthy control (n 1⁄4 30). All individuals were measured for HNF4c mRNA expression levels relative to GAPDH constitutive gene using real-time reverse-transcription polymerase chain reaction (RT-PCR) with LNA TaqMan probes from Roche (Nutley, NJ). The following gene-specific primers were used: HNF4c forward 50caacttacacaactttggagtttga-30 and reverse 50-cgttgtctgtggtattcatacttgt-30 and GAPDH forward 50-gcccaaacgaccaaatcc-30 and reverse 50-agccacatcgctgagaca-30 for normalization. The HNF4c mRNA expression was significantly decreased in the mucosa from patients with active UC compared to those UC patients in remission (P 1⁄4 0.01) and the healthy control group (P 1⁄4 0.03). On the other hand, the HNF4c expression was similar in UC remission and healthy controls, as shown in Figure 1. These results showed that HNF4c expression is downregulated in the inflammatory process of patients with UC, suggesting that the HNF4c gene could be involved as a defense mechanism and potential therapeutic agonists of HNF4c might be useful in the treatment of UC. In conclusion, HNF4c expression was significantly decreased in patients with active UC compared to UC patients in remission and healthy controls.

Interleukin-18 upregulation is associated with the use of steroids in patients with ulcerative colitis

To the Editor: Inflammatory bowel disease (IBD) comprises two forms, ulcerative colitis (UC) and Crohn’s disease (CD). Currently, the pathogenesis of IBD is not completely understood. Cytokines are key signals in the intestinal immune system and are known to participate in the disruption of the so-called normal state of controlled inflammation (physiological inflammation of the gut). In both diseases an increased production of interleukin (IL-1), IL-6, tumor necrosis factor alpha (TNF-a), and IL-18 have been reported in the inflamed mucosa. Interleukin-18 is a cytokine that initiates and promotes host defense and inflammation. IL-18 is related by mechanism of origin, receptor structure, and signal pathway with IL-33 and IL-1. The activation of the NLRP3 inflammasome results in IL-1 and IL-18 production for the conversion of procaspase-1 to caspase 1 followed by the cleavage of pro-interleukins 1 and 18. Another source of IL-18 production is represented by macrophages, keratinocytes, Kupffer cells, and intestinal epithelial cells that produce and secrete IL-18. IL-18 has been extensively studied in adults and children with CD. However, the role of IL-18 in patients with UC has not been evaluated yet. This is the first study to our best knowledge that explores IL-18 gene expression from mucosal biopsies in patients with UC. We measured IL-18 gene expression from rectum biopsies of UC patients from August 2009 to August 2010. All individuals were divided into three groups: 1) active UC (n 1⁄4 20); 2) long-term UC remission (n 1⁄4 16); and 3) healthy control group (n 1⁄4 20). Expression of mRNA IL-18 was measured by real time polymerase chain reaction (RT-PCR). The following primers were used: IL-18 left: gcttcctc tcgcaacaaact; right: tgatgcaattgtcttc tactggtt; GADPH: left agccacatcgctca gacac; and right: gcccaatacgaccaaatcc for normalization. These results showed that IL-18 mRNA expression was significantly increased in the mucosa from patients with active and remission UC compared to healthy control group (P 1⁄4 0.006 and P 1⁄4 0.007, respectively). No significant difference was found between active and remission UC groups, as shown in Figure 1. We also found that high gene expression of IL-18 was associated

More Evidence for the Genetic Susceptibility of Mexicans Population to Nonalcoholic Fatty Liver Disease through PNPLA3

BACKGROUND The gene for patatin-like phospholipase domain containing 3 (PNPLA3) is associated with nonalcoholic fatty liver disease (NAFLD) development. We previously found that Mexican indigenous population had the highest frequency reported of the PNPLA3 148M risk allele. Further, we observed a relationship between M148M genotype with elevated ALT levels in individuals with normal weight, overweight and obese. We sought to investigate whether PNPLA3 polymorphism is associated with NAFLD development in Mexicans. MATERIAL AND METHODS We enrolled 189 Mexican patients with NAFLD and 201 healthy controls. Anthropometric, metabolic, and biochemical variables were measured, and rs738409 (Ile148Met substitution) polymorphism was genotyped by sequencing. RESULTS Logistic regression analysis, using a recessive model, suggested that PNPLA3 polymorphism in Mexican population is significantly associated (OR = 1.711, 95% CI: 1.014-2.886; P = 0.044) with NAFLD. CONCLUSIONS The PNPLA3 gene is associated with NAFLD in Mexican population. More studies are required to explain the high prevalence of PNPLA3 polymorphism in Mexican-Americans, Mexican-Indians, and Mexican-Mestizos.BACKGROUND The gene for patatin-like phospholipase domain containing 3 (PNPLA3) is associated with non-alcoholic fatty liver disease (NAFLD) development. We previously found that Mexican indigenous population had the highest frequency reported of the PNPLA3 148M risk allele. Further, we observed a relationship between M148M genotype with elevated ALT levels in individuals with normal weight, overweight and obese. We sought to investigate whether PNPLA3 polymorphism is associated with NAFLD development in Mexicans. MATERIAL AND METHODS We enrolled 189 Mexican patients with NAFLD and 201 healthy controls. Anthropometric, metabolic, and biochemical variables were measured, and rs738409 (Ile148Met substitution) polymorphism was genotyped by sequencing. RESULTS Logistic regression analysis, using a recessive model, suggested that PNPLA3 polymorphism in Mexican population is significantly associated (OR = 1.711, 95% CI: 1.014-2.886; P = 0.044) with NAFLD. CONCLUSIONS The PNPLA3 gene is associated with NAFLD in Mexican population. More studies are required to explain the high prevalence of PNPLA3 polymorphism in Mexican-Americans, Mexican-Indians, and Mexican-Mestizos.