Fausto Sánchez-Muñoz

The FTO gene is associated with adulthood obesity in the Mexican population.

Common polymorphisms in the fat mass and obesity‐associated gene (FTO) have shown strong association with obesity in several populations. In the present study, we explored the association of FTO gene polymorphisms with obesity and other biochemical parameters in the Mexican population. We also assessed FTO gene expression levels in adipose tissue of obese and nonobese individuals. The study comprised 788 unrelated Mexican‐Mestizo individuals and 31 subcutaneous fat tissue biopsies from lean and obese women. FTO single‐nucleotide polymorphisms (SNPs) rs9939609, rs1421085, and rs17817449 were associated with obesity, particularly with class III obesity, under both additive and dominant models (P = 0.0000004 and 0.000008, respectively). These associations remained significant after adjusting for admixture (P = 0.000003 and 0.00009, respectively). Moreover, risk alleles showed a nominal association with lower insulin levels and homeostasis model assessment of B‐cell function (HOMA‐B), and with higher homeostasis model assessment of insulin sensitivity (HOMA‐S) only in nonobese individuals (P dom = 0.031, 0.023, and 0.049, respectively). FTO mRNA levels were significantly higher in subcutaneous fat tissue of class III obese individuals than in lean individuals (P = 0.043). Risk alleles were significantly associated with higher FTO expression in the class III obesity group (P = 0.047). In conclusion, FTO is a major risk factor for obesity (particularly class III) in the Mexican‐Mestizo population, and is upregulated in subcutaneous fat tissue of obese individuals.

Transcript levels of Toll-Like receptors 5, 8 and 9 correlate with inflammatory activity in Ulcerative Colitis

BackgroundDysregulation of innate immune response by Toll-Like Receptors (TLRs) is a key feature in Ulcerative Colitis (UC). Most studies have focused on TLR2, TLR3, and TLR4 participation in UC. However, few studies have explored other TLRs. Therefore, the aim of this study was to evaluate the mRNA profiles of TLR1 to 9 in colonic mucosa of UC patients, according to disease activity.MethodsColonic biopsies were taken from colon during colonoscopy in 51 patients with Ulcerative Colitis and 36 healthy controls. mRNA levels of TLR1 to 9, Tollip, inflammatory cytokines IL6 and TNF were assessed by RT-qPCR with hydrolysis probes. Characterization of TLR9 protein expression was performed by Immunohistochemistry.ResultsToll-like receptors TLR8, TLR9, and IL6 mRNA levels were significantly higher in the colonic mucosa from UC patients (both quiescent and active) as compared to healthy individuals (p < 0.04). In the UC patients group the TLR2, TLR4, TLR8 and TLR9 mRNA levels were found to be significantly lower in patients with quiescent disease, as compared to those with active disease (p < 0.05), whereas TLR5 showed a trend (p = 0.06). IL6 and TNF mRNA levels were significantly higher in the presence of active disease and help to discriminate between quiescent and active disease (p < 0.05). Also, IL6 and TNF mRNA positively correlate with TLRs mRNA with the exception for TLR3, with stronger correlations for TLR5, TLR8, and TLR9 (p < 0.0001). TLR9 protein expression was mainly in the lamina propria infiltrate.ConclusionsThis study demonstrates that TLR2, TLR4, TLR8, and TLR9 expression increases in active UC patients, and that the mRNA levels positively correlate with the severity of intestinal inflammation as well as with inflammatory cytokines.

Participation of mammary gland in long-chain polyunsaturated fatty acid synthesis during pregnancy and lactation in rats

Metabolic adaptations are triggered in the maternal organism to synthesize milk with an adequate concentration of long-chain polyunsaturated fatty acids (LC-PUFAs) required to the newborn. They may be a high uptake of dietary linoleic acid and its conversion to LC-PUFAs by desaturases of fatty acids (FADS) 1 and 2 in the mammary gland (MG). It is unknown if they also occur from onset of pregnancy. The aim of this study was to explore the participation of the MG as a mechanism involved in LC-PUFAs synthesis to support their demand during pregnancy and lactation in rats. The expression of desaturases in MG was significantly (P<0.05) higher (12.3-fold for FADS1 and 41.2-fold for FADS2) during the late pregnancy and throughout lactation (31.7-fold for FADS1 and 67.1-fold higher for FADS2) than in nonpregnant rats. SREBF-1c showed a similar pattern of increase during pregnancy but remained higher only during the early lactation (11.7-fold, P<0.005). Transcript of ELOVL6 and FASN increased throughout pregnancy and lactation, respectively. ELOVL5 mRNA increased in MG only during lactation (2.8 to 5.3-fold, P<0.005). Accordingly, a higher content of LC-PUFAs was found in lactating MG than in nonpregnant rats. Results suggest that MG participates from late pregnancy and throughout lactation by expressing desaturases and elongases as a mechanism involved in LC-PUFAs synthesis, probably by SREBF-1c. Because desaturases and ELOVL5 were expressed in cultured lactocytes and such expression was downregulated by linoleic and arachidonic acid, these cells may be a useful model for understanding the regulatory mechanisms for LC-PUFAs synthesis in MG.

Colonic epithelial upregulation of interleukin 22 (IL-22) in patients with ulcerative colitis.

To the Editor: Inflammatory bowel disease (IBD) is a chronic inflammatory disease thought to be mediated by dysfunctional innate and/or adaptive immunity. This aberrant immune response leads to the secretion of harmful cytokines that destroy the epithelium of the gastrointestinal tract and thus cause further inflammation. Interleukin (IL)-22, a member of the IL-10 subfamily, is a recently identified T-cell-derived cytokine. Expression of IL-22 is induced in several human inflammatory conditions, including IBD. A recent article published by Sugimoto et al found that IL-22 gene delivery led to rapid amelioration of local intestinal inflammation in a dextran sulfate sodium-induced model of acute colitis. Expression of the IL-22 receptor is restricted to innate immune cells; however, the role of IL22 in ulcerative colitis (UC) patients has not yet been defined. This is the first study to our best knowledge with a larger sample that explores IL-22 gene expression from rectal biopsies in patients with UC. We measured the IL22 gene expression from rectum biopsies of UC patients from September 2008 to September 2009. All individuals were divided in 3 groups: 1) active UC (n 1⁄4 26); 2) long-term UC remission (n 1⁄4 11); and 3) a healthy control group (n 1⁄4 18). Expression of mRNA IL-22 was measured with a real-time polymerase chain reaction (RT-PCR) method. The following primers were used: IL-22 forward: ccctcaatctgataggttccag and reverse: gcaggtcatcaccttcaatatg; GADPH forward: gcccaatac gaccaaatcc and reverse: agccacatcgctcagaca for normalization. These results showed that IL-22 mRNA expression was upregulated in rectal mucosa from patients with active UC compared to UC patients in remission and healthy controls (P < 0.04 and P < 0.0001, respectively). Interestingly, the expression of IL-22 was also significantly increased in remission UC as compared to normal controls (P < 0.01) as shown in Figure 1. We also found that IL-22 gene expression correlated with histological activity (r 1⁄4 0.63 P < 0.0007) by Spearman correlation test. These findings confirmed the potential role of the IL-22 gene in the pathogenesis of UC and suggests that IL-22 might be involved as a defense mechanism by enhanced mucus production. In conclusion, gene expression of IL-22 was found to be increased from rectal biopsies in patients with UC.

Association of the I148M/PNPLA3 variant with elevated alanine transaminase levels in normal-weight and overweight/obese Mexican children

BACKGROUND AND AIMS Non-alcoholic fatty liver disease (NAFLD) and elevated alanine transaminase (ALT) levels are common in obese Hispanic adults and children. Recently, a PNPLA3 gene variant (I148M) was strongly associated with NAFLD and higher ALT levels in obese adults, including Hispanics. The aims of this study were to estimate the frequency of elevated ALT levels, and to address the influence of obesity and PNPLA3/I148M on ALT levels in a general population sample of Mexican school-aged children. METHODS A total of 1037 non-related Mexican children aged 6 to 12 years were genotyped for the I148M variant. Anthropometric, clinical and metabolic parameters were collected from all participants. RESULTS Elevated ALT levels (>35 U/L) were more frequent in obese (26.9%) and overweight (9.3%) than in normal weight children (2.2%). The M148M genotype was significantly associated with elevated ALT levels in this population (OR=3.7, 95% CI 2.3-5.9; P=3.7×10(-8)), and children carrying the M148M genotype showed significantly lower HDL cholesterol levels and BMI z-core (P=0.036 and 0.015, respectively). On stratifying by BMI percentile, this genotype conferred a much greater risk of elevated ALT levels in normal weight (OR=19.9, 95% CI 2.5-157.7; P=0.005) than overweight and obese children (OR=3.4, 95% CI 1.3-8.9; P=0.014 and OR=3.1, 95% CI 1.7-5.5; P=1.4 x10(-4), respectively). CONCLUSIONS The I148M PNPLA3 variant is strongly associated with elevated ALT levels in normal weight and overweight/obese Mexican children. Thus, the M148M genotype may be considered as an important risk factor for liver damage in this population.

Anti-tumor necrosis factor VNAR single domains reduce lethality and regulate underlying inflammatory response in a murine model of endotoxic shock.

BackgroundIn sepsis, tumor necrosis factor (TNF) is the key factor triggering respiratory burst, tissue injury and disseminated coagulation. Anti-TNF strategies based on monoclonal antibodies or F(ab’)2 fragments have been used in sepsis with contradictory results. Immunoglobulin new antigen receptors (IgNAR) are a unique subset of antibodies consisting of five constant (CNAR) and one variable domains (VNAR). VNAR domains are the smallest, naturally occurring, antibody-based immune recognition units, having potential use as therapy.Our aim was to explore the impact of an anti-TNF VNAR on survival in an experimental model of endotoxic shock. Also, mRNA expression and serum protein of several inflammatory molecules were measured.ResultsEndotoxic shock was induced by lipopolysaccharide (LPS) in male Balb/c mice. Animals were treated with anti-TNF VNAR domains, F(ab’)2 antibody fragments, or saline solution 15 minutes before, 2 h and 24 h after lethal dose100 (LD100) LPS administration. TNF blockade with either VNAR domains or F(ab’)2 fragments were associated with lower mortality (60% and 75%, respectively) compared to LD100. Challenge with LPS induced significant production of serum TNF and interleukins -10 and -6 at 3 h. After that, significant reduction of IL-6 at 24 h (vs 3 h) was shown only in the VNAR group. Nitrites level also increased in response to LPS.In liver, TNF and IL-10 mRNA expression showed a pro-inflammatory imbalance in response to LPS. Blocking TNF was associated with a shift towards an anti-inflammatory status; however, polarization was more pronounced in animals receiving F(ab’)2 fragments than in those with VNAR therapy. With regard to IL-6, gene expression was increased at 3 h in all groups. TNF blockade was associated with rapid and sustained suppression of IL-6 expression, even more evident in the VNAR group. Finally, expression of inducible-nitric oxide synthase (iNOS) increased in response to LPS at 3 h, but this was decreased at 24 h only in the anti-TNF VNAR group.ConclusionsAnti-TNF VNAR single domains improved survival in a murine model of endotoxic shock. Protection was associated with regulation in the TNF/IL-10 balance, attenuation of IL-6 and iNOS gene expression in the liver as well as decreased serum IL-6 concentration.

Hepatic miR-33a/miR-144 and their target gene ABCA1 are associated with steatohepatitis in morbidly obese subjects.

Abnormal cholesterol metabolism may contribute to the pathogenesis of non‐alcoholic steatohepatitis (NASH) and fibrosis. miR‐33 and miR‐144 regulate adenosine triphosphate binding cassette transporter (ABCA1) and other target genes involved in cholesterol efflux, fatty acid oxidation and inflammation. We explored relationships between non‐alcoholic fatty liver disease (NAFLD) and the hepatic expression of ABCA1/ABCG1, as well as other target genes regulated by miR‐33 (carnitine O‐octanoyltransferase, CROT and hydroxyacyl‐CoA‐dehydrogenase β‐subunit, HADHB) and miR‐144 (toll‐like receptor‐2, TLR2). Moreover, we evaluated whether the expression of these genes is correlated with miR‐33a/b and miR‐144 expression in Mexican individuals with morbid obesity.

TLR9 mRNA expression is upregulated in patients with active ulcerative colitis

To the Editor: TLR9 is a member of the innate immunity Toll-like receptors (TLRs) family that recognizes bacterial unmethylated CpG DNA motifs. In experimental models of colitis, activation of TLR9 with artificial CpG ODN has proven beneficial. Also, TLR9 was reported to mediate interleukin 8 (IL8) production in colonic epithelial cell lines in response to DNA from pathogenic bacteria. Genetic studies have shown that polymorphisms in TLRs may participate in both Crohn’s disease (CD) and ulcerative colitis (UC). In particular, TLR9 ( 1237T/C) polymorphism has recently been implicated in the development of IBD. Recently, Ghadimi at al showed that TLR9 activation by commensal-origin bacteria DNA is important in the induction of IL-8 production. To our best knowledge, this is the first study designed to evaluate TLR9 gene expression from rectal biopsies in patients with UC. We quantified mRNA levels in rectal biopsy specimens from UC patients and healthy controls. Forty-nine rectal biopsies were obtained from a first cohort group that consisted of 38 UC patients (22 active and 16 remission) as well as 11 healthy controls. All individuals were assessed for TLR9 and IL-6 mRNA transcript levels relative to RPLP0 constitutive gene using real-time reverse-transcription polymerase chain reaction (RT-PCR) using LNA TaqMan probes from Roche (Nutley, NJ) in combination with target gene-specific primers (primer sequences: TLR9 50-TGTGAAGCATG GTTCCCTGT-30, 50-GAGAGACAGCG GGTGCAG-30, IL6 50-GCCCAGCTAT GAACTCCTTCT-30, 50-GAAGGCAGC AGGCAACAC-30 RPLP0 50-ACAGGG CGACCTGGAAGT-30, 50-GGATCTGC TGCATCTGCTT-30). In order to confirm these findings, we also studied a second cohort group that consisted of 36 UC patients (27 active, 9 remission) and 22 healthy controls. Both cohorts were also assessed for TLR9 and IL-6 mRNA relative to RPLP0 as previously described. All results were calibrated to the same control sample performed in all experiments in both cohorts. Also, to solve a possible bias from housekeeping selection both b-actin (50-CCAACCGC GAGAAGATGA-30, 50-CCAGAGGCG TACAGGGATAG-30) and GAPDH (50AGCCACATCGCTCAGACAC-30, 50-G CCCAATACGACCAAATCC-30) were also assessed in the second cohort group. Analysis of the whole sample showed that TLR9 mRNA levels were found significantly increased in the UC active group when compared with healthy controls and patients with UC in remission and healthy controls (Fig. 1A). A good correlation was found between TLR9 with IL6 (r 1⁄4 0.603 P < 0.001) (Fig. 1B). Results from the

Interleukin 21 Expression Is Increased in Rectal Biopsies from Patients with Ulcerative Colitis

To the Editor: Interleukin 21 (IL-21) is a T-cell derived cytokine member of the common gamma-chain-dependent cytokine family, which in general acts on intestinal epithelium helping to maintain the ongoing Th1 inflammation inducing the production of IFN-c. IL-21 also has shown to enhance the expansion of NK cells. IL-21 is expressed by immune T and B cells and nonimmune-like fibroblasts where it activates the metalloproteinase 1 production, signaling through its receptor IL-21R activates STAT-3 in T cells. IL-21, like IL-6 and IL-23, is also involved in Th17 cell differentiation and it is overexpressed in Crohn’s disease (CD). Genetic variants in the region harboring IL2/IL21 have been associated with the genetic susceptibility for developing ulcerative colitis (UC). A recent study has reported IL-21 receptor (IL-21R)-positive cells were significantly increased in inflamed mucosa of inflammatory bowel disease (IBD) patients compared with controls, and mainly expressed in freshly isolated peripheral blood (PB) and lamina propria (LP)-CD4(þ), CD8(þ) T, B, and NK cells. However, this is the first study to our best knowledge with a larger sample that explores the IL-21 gene expression from rectal biopsies in patients with UC. We measured the IL-21 gene expression from rectum biopsies of UC patients from September 2008 to July 2009. All individuals were divided into 3 groups: 1) active UC (n 1⁄4 21); 2) long-term UC remission (n 1⁄4 21); and 3) normal control group (n 1⁄4 20). Expression of mRNA IL-21 and IL-6 were measured by real time polymerase chain reaction (RT-PCR). The following primers were used: IL-21 forward: aggaaaccaccttccacaaa and reverse: gaatcacatgaagggcatgtt; GADPH forward: gcccaatac gaccaaatcc and reverse: agccacatcgctcagaca for normalization. These results showed that IL-21 mRNA expression was increased in rectal mucosa from patients with active UC compared to UC patients in remission and the healthy control group (P 1⁄4 0.025 and P 1⁄4 0.007, respectively). The IL-21 expression was similar in patients with UC in remission and the healthy control group (P 1⁄4 0.546), as shown in Figure 1. We also found that IL-21 gene expression correlated with histological activity (r 1⁄4 0.675, P 1⁄4 0.001) by Spearman correlation test. These findings confirmed the potential role of IL21 gene in the pathogenesis of UC and suggest that antibodies directed to IL21 could be used as a potential target for treating patients with IBD. In conclusion, high gene expression of IL-21 was found from rectal biopsies in patients with UC.

IFN-stimulated Gene Expression Is a Useful Potential Molecular Marker of Response to Antiviral Treatment with Peg-IFNα 2b and Ribavirin in Patients with Hepatitis C Virus Genotype 1

BACKGROUND AND AIMS We undertook this study to determine the baseline gene expression of IFI27, IFIT1, IFI6, ISG15, IRF-1, IRF-3, OAS-2 and CXCL10 and its usefulness as molecular markers of response to antiviral treatment with peg-IFNα 2b/RBV in patients with hepatitis C virus genotype 1 (HCV-1). METHODS Gene expression was analyzed by RT-PCR in baseline liver biopsies from 42 HCV-1 patients who were treated with Peg-IFNα 2b/RBV for 48 weeks. In addition, we investigated gene expression of these genes in a second liver biopsy obtained 24 weeks post-treatment in sustained viral response (SVR) and relapser patients. RESULTS Thirteen patients achieved SVR, four were relapsers, four patients with viral response (VR) discontinued the following for 24 weeks post-treatment and 21 patients did not respond to antiviral therapy (NR). All patients with HCV-1 showed gene overexpression in baseline liver tissue, but only IFI27, IFIT1, IFI6, ISG15, and CXCL10 showed differential gene expression, which is inversely related to the response to antiviral therapy. Thus, liver tissue of NR patients showed upregulation of these genes, whereas patients with SVR gene expression level was significantly lower. Furthermore, 24 weeks afterwards treatment, SVR patients showed a significant downregulation of such genes, which was consistent with the RNA-HCV suppression. ISGs (IFI27, IFIT1, IFI6) and chemokine CXCL10 showed the best positive and negative predictive values on SVR to IFN/RBV therapy (range: 70.8-75% and 71.43-82.35%), respectively. CONCLUSIONS IFI27, IFIT1, IFI6, ISG15, and CXCL10 genes are potential biological markers useful for predicting response to Peg-IFNα 2b/RBV therapy in HCV-1 patients.