Andrea Gallavotti

The role of barren stalk1 in the architecture of maize

The architecture of higher plants is established through the activity of lateral meristems—small groups of stem cells formed during vegetative and reproductive development. Lateral meristems generate branches and inflorescence structures, which define the overall form of a plant, and are largely responsible for the evolution of different plant architectures. Here, we report the isolation of the barren stalk1 gene, which encodes a non-canonical basic helix–loop–helix protein required for the initiation of all aerial lateral meristems in maize. barren stalk1 represents one of the earliest genes involved in the patterning of maize inflorescences, and, together with the teosinte branched1 gene, it regulates vegetative lateral meristem development. The architecture of maize has been a major target of selection for early agriculturalists and modern farmers, because it influences harvesting, breeding strategies and mechanization. By sampling nucleotide diversity in the barren stalk1 region, we show that two haplotypes entered the maize gene pool from its wild progenitor, teosinte, and that only one was incorporated throughout modern inbreds, suggesting that barren stalk1 was selected for agronomic purposes.

sparse inflorescence1 encodes a monocot-specific YUCCA-like gene required for vegetative and reproductive development in maize

The plant growth hormone auxin plays a critical role in the initiation of lateral organs and meristems. Here, we identify and characterize a mutant, sparse inflorescence1 (spi1), which has defects in the initiation of axillary meristems and lateral organs during vegetative and inflorescence development in maize. Positional cloning shows that spi1 encodes a flavin monooxygenase similar to the YUCCA (YUC) genes of Arabidopsis, which are involved in local auxin biosynthesis in various plant tissues. In Arabidopsis, loss of function of single members of the YUC family has no obvious effect, but in maize the mutation of a single yuc locus causes severe developmental defects. Phylogenetic analysis of the different members of the YUC family in moss, monocot, and eudicot species shows that there have been independent expansions of the family in monocots and eudicots. spi1 belongs to a monocot-specific clade, within which the role of individual YUC genes has diversified. These observations, together with expression and functional data, suggest that spi1 has evolved a dominant role in auxin biosynthesis that is essential for normal maize inflorescence development. Analysis of the interaction between spi1 and genes regulating auxin transport indicate that auxin transport and biosynthesis function synergistically to regulate the formation of axillary meristems and lateral organs in maize.

The control of axillary meristem fate in the maize ramosa pathway

Plant axillary meristems are composed of highly organized, self-renewing stem cells that produce indeterminate branches or terminate in differentiated structures, such as the flowers. These opposite fates, dictated by both genetic and environmental factors, determine interspecific differences in the architecture of plants. The Cys2-His2 zinc-finger transcription factor RAMOSA1 (RA1) regulates the fate of most axillary meristems during the early development of maize inflorescences, the tassel and the ear, and has been implicated in the evolution of grass architecture. Mutations in RA1 or any other known members of the ramosa pathway, RAMOSA2 and RAMOSA3, generate highly branched inflorescences. Here, we report a genetic screen for the enhancement of maize inflorescence branching and the discovery of a new regulator of meristem fate: the RAMOSA1 ENHANCER LOCUS2 (REL2) gene. rel2 mutants dramatically increase the formation of long branches in ears of both ra1 and ra2 mutants. REL2 encodes a transcriptional co-repressor similar to the TOPLESS protein of Arabidopsis, which is known to maintain apical-basal polarity during embryogenesis. REL2 is capable of rescuing the embryonic defects of the Arabidopsis topless-1 mutant, suggesting that REL2 also functions as a transcriptional co-repressor throughout development. We show by genetic and molecular analyses that REL2 physically interacts with RA1, indicating that the REL2/RA1 transcriptional repressor complex antagonizes the formation of indeterminate branches during maize inflorescence development. Our results reveal a novel mechanism for the control of meristem fate and the architecture of plants.

The role of auxin in shaping shoot architecture

The variety of plant architectures observed in nature is predominantly determined by vegetative and reproductive branching patterns, the positioning of lateral organs, and differential stem elongation. Branches, lateral organs, and stems are the final products of the activity of meristems, groups of stem cells whose function is genetically determined and environmentally influenced. Several decades of studies in different plant species have shed light on the essential role of the hormone auxin in plant growth and development. Auxin influences stem elongation and regulates the formation, activity, and fate of meristems, and has therefore been recognized as a major hormone shaping plant architecture. Increasing our knowledge of the molecular mechanisms that regulate auxin function is necessary to understand how different plant species integrate a genetically determined developmental programme, the establishment of a body plan, with constant inputs from the surrounding environment. This information will allow us to develop the molecular tools needed to modify plant architecture in several crop species and in rapidly changing environments.

Transport of Boron by the tassel-less1 Aquaporin Is Critical for Vegetative and Reproductive Development in Maize

Identification and analysis of the maize boron (B) transporter mutant tassel-less1 demonstrated that the primary symptoms of B deficiency are defects in vegetative and reproductive meristems, thus providing an explanation for the reductions in yield observed under B-limited conditions. The element boron (B) is an essential plant micronutrient, and B deficiency results in significant crop losses worldwide. The maize (Zea mays) tassel-less1 (tls1) mutant has defects in vegetative and inflorescence development, comparable to the effects of B deficiency. Positional cloning revealed that tls1 encodes a protein in the aquaporin family co-orthologous to known B channel proteins in other species. Transport assays show that the TLS1 protein facilitates the movement of B and water into Xenopus laevis oocytes. B content is reduced in tls1 mutants, and application of B rescues the mutant phenotype, indicating that the TLS1 protein facilitates the movement of B in planta. B is required to cross-link the pectic polysaccharide rhamnogalacturonan II (RG-II) in the cell wall, and the percentage of RG-II dimers is reduced in tls1 inflorescences, indicating that the defects may result from altered cell wall properties. Plants heterozygous for both tls1 and rotten ear (rte), the proposed B efflux transporter, exhibit a dosage-dependent defect in inflorescence development under B-limited conditions, indicating that both TLS1 and RTE function in the same biological processes. Together, our data provide evidence that TLS1 is a B transport facilitator in maize, highlighting the importance of B homeostasis in meristem function.

BARREN STALK FASTIGIATE1 Is an AT-Hook Protein Required for the Formation of Maize Ears

This work reports the identification of a new regulator of axillary meristem formation in maize, showing that BARREN STALK FASTIGIATE1 likely functions as a boundary determinant for axillary meristem primordia. In addition, it reveals that BARREN STALK FASTIGIATE1 is involved in the regulation of Barren stalk1, a major player in the initiation of axillary meristems. Ears are the seed-bearing inflorescences of maize (Zea mays) plants and represent a crucial component of maize yield. The first step in the formation of ears is the initiation of axillary meristems in the axils of developing leaves. In the classic maize mutant barren stalk fastigiate1 (baf1), first discovered in the 1950s, ears either do not form or, if they do, are partially fused to the main stalk. We positionally cloned Baf1 and found that it encodes a transcriptional regulator containing an AT-hook DNA binding motif. Single coorthologs of Baf1 are found in syntenic regions of brachypodium (Brachypodium distachyon), rice (Oryza sativa), and sorghum (Sorghum bicolor), suggesting that the gene is likely present in all cereal species. Protein–protein interaction assays suggest that BAF1 is capable of forming homodimers and heterodimers with other members of the AT-hook family. Another transcriptional regulator required for ear initiation is the basic helix-loop-helix protein BARREN STALK1 (BA1). Genetic and expression analyses suggest that Baf1 is required to reach a threshold level of Ba1 expression for the initiation of maize ears. We propose that Baf1 functions in the demarcation of a boundary region essential for the specification of a stem cell niche.

The Boron Efflux Transporter ROTTEN EAR Is Required for Maize Inflorescence Development and Fertility

This work reports the isolation and characterization of a mutant called rotten ear (rte), which shows growth and fertility defects in maize inflorescences. rte is required for the uptake and transport of the micronutrient boron and is necessary for the structural integrity of maize cell walls. Although boron has a relatively low natural abundance, it is an essential plant micronutrient. Boron deficiencies cause major crop losses in several areas of the world, affecting reproduction and yield in diverse plant species. Despite the importance of boron in crop productivity, surprisingly little is known about its effects on developing reproductive organs. We isolated a maize (Zea mays) mutant, called rotten ear (rte), that shows distinct defects in vegetative and reproductive development, eventually causing widespread sterility in its inflorescences, the tassel and the ear. Positional cloning revealed that rte encodes a membrane-localized boron efflux transporter, co-orthologous to the Arabidopsis thaliana BOR1 protein. Depending on the availability of boron in the soil, rte plants show a wide range of phenotypic defects that can be fully rescued by supplementing the soil with exogenous boric acid, indicating that rte is crucial for boron transport into aerial tissues. rte is expressed in cells surrounding the xylem in both vegetative and reproductive tissues and is required for meristem activity and organ development. We show that low boron supply to the inflorescences results in widespread defects in cell and cell wall integrity, highlighting the structural importance of boron in the formation of fully fertile reproductive organs.

Auxin signaling modules regulate maize inflorescence architecture.

Significance Axillary meristems are groups of plant pluripotent stem cells responsible for the formation of secondary axes of growth, such as branches and flowers. A crucial step in the initiation of new axillary meristems is the establishment of boundary domains that allow organ separation and prevent fusion defects during development. This work provides clues on the molecular mechanism by which the plant hormone auxin is involved in the formation of axillary meristems in maize inflorescences. Auxin signaling modules containing the AUXIN/INDOLE-3-ACETIC ACID proteins BARREN INFLORESCENCE1 and BARREN INFLORESCENCE4 and AUXIN RESPONSE FACTOR (ARF) transcriptional regulators are involved in the regulation of the boundary basic helix-loop-helix transcription factor BARREN STALK1, suggesting auxin is directly responsible for establishing boundary regions. In plants, small groups of pluripotent stem cells called axillary meristems are required for the formation of the branches and flowers that eventually establish shoot architecture and drive reproductive success. To ensure the proper formation of new axillary meristems, the specification of boundary regions is required for coordinating their development. We have identified two maize genes, BARREN INFLORESCENCE1 and BARREN INFLORESCENCE4 (BIF1 and BIF4), that regulate the early steps required for inflorescence formation. BIF1 and BIF4 encode AUXIN/INDOLE-3-ACETIC ACID (Aux/IAA) proteins, which are key components of the auxin hormone signaling pathway that is essential for organogenesis. Here we show that BIF1 and BIF4 are integral to auxin signaling modules that dynamically regulate the expression of BARREN STALK1 (BA1), a basic helix-loop-helix (bHLH) transcriptional regulator necessary for axillary meristem formation that shows a striking boundary expression pattern. These findings suggest that auxin signaling directly controls boundary domains during axillary meristem formation and define a fundamental mechanism that regulates inflorescence architecture in one of the most widely grown crop species.

Erratum: Cistrome and Epicistrome Features Shape the Regulatory DNA Landscape (Cell (2016) 165(5) (1280–1292))

In the Supplemental Experimental Procedures, the Adaptor B sequence shown was missing the 50 phosphate modification required for ligation, and the Illumina TruSeq Index primer was shown as the reverse complement of the sequence used in the analyses. The correct sequences are: Adaptor B: 50 P-GATCGGAAGAGCACACGTCTG and TruSeq Index primer: 50-CAAGCAGAAGACGGCATAC GAGAT-NNNNNN GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC (where the NNNNNN represents the six-base-pair sequence index used for sample identification).

Expanding the Regulatory Network for Meristem Size in Plants

The remarkable plasticity of post-embryonic plant development is due to groups of stem-cell-containing structures called meristems. In the shoot, meristems continuously produce organs such as leaves, flowers, and stems. Nearly two decades ago the WUSCHEL/CLAVATA (WUS/CLV) negative feedback loop was established as being essential for regulating the size of shoot meristems by maintaining a delicate balance between stem cell proliferation and cell recruitment for the differentiation of lateral primordia. Recent research in various model species (Arabidopsis, tomato, maize, and rice) has led to discoveries of additional components that further refine and improve the current model of meristem regulation, adding new complexity to a vital network for plant growth and productivity.