Mary Galli
Salk Institute for Biological Studies
Network
Latest external collaboration on country level. Dive into details by clicking on the dots.
Publication
Featured researches published by Mary Galli.
Science | 2011
M. Shahid Mukhtar; Anne-Ruxandra Carvunis; Matija Dreze; Petra Epple; Jens Steinbrenner; Jonathan D. Moore; Murat Tasan; Mary Galli; Tong Hao; Marc T. Nishimura; Samuel J. Pevzner; Susan E. Donovan; Lila Ghamsari; Balaji Santhanam; Viviana Romero; Matthew M. Poulin; Fana Gebreab; Bryan J. Gutierrez; Stanley Tam; Dario Monachello; Mike Boxem; Christopher J. Harbort; Nathan A. McDonald; Lantian Gai; Huaming Chen; Yijian He; Jean Vandenhaute; Frederick P. Roth; David E. Hill; Joseph R. Ecker
An analysis of protein-protein interactions in Arabidopsis identifies the plant interactome. Plants generate effective responses to infection by recognizing both conserved and variable pathogen-encoded molecules. Pathogens deploy virulence effector proteins into host cells, where they interact physically with host proteins to modulate defense. We generated an interaction network of plant-pathogen effectors from two pathogens spanning the eukaryote-eubacteria divergence, three classes of Arabidopsis immune system proteins, and ~8000 other Arabidopsis proteins. We noted convergence of effectors onto highly interconnected host proteins and indirect, rather than direct, connections between effectors and plant immune receptors. We demonstrated plant immune system functions for 15 of 17 tested host proteins that interact with effectors from both pathogens. Thus, pathogens from different kingdoms deploy independently evolved virulence proteins that interact with a limited set of highly connected cellular hubs to facilitate their diverse life-cycle strategies.
Cell Reports | 2014
Jose L. Pruneda-Paz; Ghislain Breton; Dawn H. Nagel; S. Earl Kang; Katia Bonaldi; Colleen J. Doherty; Stephanie Ravelo; Mary Galli; Joseph R. Ecker; Steve A. Kay
Extensive transcriptional networks play major roles in cellular and organismal functions. Transcript levels are in part determined by the combinatorial and overlapping functions of multiple transcription factors (TFs) bound to gene promoters. Thus, TF-promoter interactions provide the basic molecular wiring of transcriptional regulatory networks. In plants, discovery of the functional roles of TFs is limited by an increased complexity of network circuitry due to a significant expansion of TF families. Here, we present the construction of a comprehensive collection of Arabidopsis TFs clones created to provide a versatile resource for uncovering TF biological functions. We leveraged this collection by implementing a high-throughput DNA binding assay and identified direct regulators of a key clock gene (CCA1) that provide molecular links between different signaling modules and the circadian clock. The resources introduced in this work will significantly contribute to a better understanding of the transcriptional regulatory landscape of plant genomes.
The Plant Cell | 2014
Mithu Chatterjee; Zara Tabi; Mary Galli; Simon T. Malcomber; Amy Buck; Michael Muszynski; Andrea Gallavotti
This work reports the isolation and characterization of a mutant called rotten ear (rte), which shows growth and fertility defects in maize inflorescences. rte is required for the uptake and transport of the micronutrient boron and is necessary for the structural integrity of maize cell walls. Although boron has a relatively low natural abundance, it is an essential plant micronutrient. Boron deficiencies cause major crop losses in several areas of the world, affecting reproduction and yield in diverse plant species. Despite the importance of boron in crop productivity, surprisingly little is known about its effects on developing reproductive organs. We isolated a maize (Zea mays) mutant, called rotten ear (rte), that shows distinct defects in vegetative and reproductive development, eventually causing widespread sterility in its inflorescences, the tassel and the ear. Positional cloning revealed that rte encodes a membrane-localized boron efflux transporter, co-orthologous to the Arabidopsis thaliana BOR1 protein. Depending on the availability of boron in the soil, rte plants show a wide range of phenotypic defects that can be fully rescued by supplementing the soil with exogenous boric acid, indicating that rte is crucial for boron transport into aerial tissues. rte is expressed in cells surrounding the xylem in both vegetative and reproductive tissues and is required for meristem activity and organ development. We show that low boron supply to the inflorescences results in widespread defects in cell and cell wall integrity, highlighting the structural importance of boron in the formation of fully fertile reproductive organs.
Proceedings of the National Academy of Sciences of the United States of America | 2015
Mary Galli; Qiujie Liu; Britney L. Moss; Simon T. Malcomber; Wei Li; Craig Gaines; Silvia Federici; Jessica Roshkovan; Robert B. Meeley; Jennifer L. Nemhauser; Andrea Gallavotti
Significance Axillary meristems are groups of plant pluripotent stem cells responsible for the formation of secondary axes of growth, such as branches and flowers. A crucial step in the initiation of new axillary meristems is the establishment of boundary domains that allow organ separation and prevent fusion defects during development. This work provides clues on the molecular mechanism by which the plant hormone auxin is involved in the formation of axillary meristems in maize inflorescences. Auxin signaling modules containing the AUXIN/INDOLE-3-ACETIC ACID proteins BARREN INFLORESCENCE1 and BARREN INFLORESCENCE4 and AUXIN RESPONSE FACTOR (ARF) transcriptional regulators are involved in the regulation of the boundary basic helix-loop-helix transcription factor BARREN STALK1, suggesting auxin is directly responsible for establishing boundary regions. In plants, small groups of pluripotent stem cells called axillary meristems are required for the formation of the branches and flowers that eventually establish shoot architecture and drive reproductive success. To ensure the proper formation of new axillary meristems, the specification of boundary regions is required for coordinating their development. We have identified two maize genes, BARREN INFLORESCENCE1 and BARREN INFLORESCENCE4 (BIF1 and BIF4), that regulate the early steps required for inflorescence formation. BIF1 and BIF4 encode AUXIN/INDOLE-3-ACETIC ACID (Aux/IAA) proteins, which are key components of the auxin hormone signaling pathway that is essential for organogenesis. Here we show that BIF1 and BIF4 are integral to auxin signaling modules that dynamically regulate the expression of BARREN STALK1 (BA1), a basic helix-loop-helix (bHLH) transcriptional regulator necessary for axillary meristem formation that shows a striking boundary expression pattern. These findings suggest that auxin signaling directly controls boundary domains during axillary meristem formation and define a fundamental mechanism that regulates inflorescence architecture in one of the most widely grown crop species.
Proceedings of the National Academy of Sciences of the United States of America | 2016
Junshi Yazaki; Mary Galli; Alice Y. Kim; Kazumasa Nito; Fernando Alemán; Katherine N. Chang; Anne-Ruxandra Carvunis; Rosa Quan; Hien Nguyen; Liang Song; José Miguel Álvarez; Shao-shan Carol Huang; Huaming Chen; Stefan Altmann; Rodrigo A. Gutiérrez; David E. Hill; Julian I. Schroeder; Joanne Chory; Joshua LaBaer; Marc Vidal; Pascal Braun; Joseph R. Ecker
Significance Using a newly developed technology, HaloTag nucleic acid programmable protein array (HaloTag-NAPPA), we increase the capacity of in situ protein microarray technology several-fold, such that proteome-scale screening becomes feasible. Many examples of novel protein–protein interactions (PPIs) among plant signaling pathways were observed. With few exceptions, nearly all of these connections are undocumented in the existing literature. This study has resulted in an important new resource for the plant biology community—a plant transcription factor-anchored protein–protein interaction network map. Such transcription factor- and transcriptional regulator-based PPI networks may help in the identification of novel genes for use in the improvement of agronomic traits such as grain quality, disease resistance, and stress tolerance. Protein microarrays enable investigation of diverse biochemical properties for thousands of proteins in a single experiment, an unparalleled capacity. Using a high-density system called HaloTag nucleic acid programmable protein array (HaloTag-NAPPA), we created high-density protein arrays comprising 12,000 Arabidopsis ORFs. We used these arrays to query protein–protein interactions for a set of 38 transcription factors and transcriptional regulators (TFs) that function in diverse plant hormone regulatory pathways. The resulting transcription factor interactome network, TF-NAPPA, contains thousands of novel interactions. Validation in a benchmarked in vitro pull-down assay revealed that a random subset of TF-NAPPA validated at the same rate of 64% as a positive reference set of literature-curated interactions. Moreover, using a bimolecular fluorescence complementation (BiFC) assay, we confirmed in planta several interactions of biological interest and determined the interaction localizations for seven pairs. The application of HaloTag-NAPPA technology to plant hormone signaling pathways allowed the identification of many novel transcription factor–protein interactions and led to the development of a proteome-wide plant hormone TF interactome network.
Cell | 2016
Ronan O'Malley; Shao-shan Carol Huang; Liang Song; Mathew G. Lewsey; Anna Bartlett; Joseph R. Nery; Mary Galli; Andrea Gallavotti; Joseph R. Ecker
In the Supplemental Experimental Procedures, the Adaptor B sequence shown was missing the 50 phosphate modification required for ligation, and the Illumina TruSeq Index primer was shown as the reverse complement of the sequence used in the analyses. The correct sequences are: Adaptor B: 50 P-GATCGGAAGAGCACACGTCTG and TruSeq Index primer: 50-CAAGCAGAAGACGGCATAC GAGAT-NNNNNN GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC (where the NNNNNN represents the six-base-pair sequence index used for sample identification).
Trends in Genetics | 2016
Mary Galli; Andrea Gallavotti
The remarkable plasticity of post-embryonic plant development is due to groups of stem-cell-containing structures called meristems. In the shoot, meristems continuously produce organs such as leaves, flowers, and stems. Nearly two decades ago the WUSCHEL/CLAVATA (WUS/CLV) negative feedback loop was established as being essential for regulating the size of shoot meristems by maintaining a delicate balance between stem cell proliferation and cell recruitment for the differentiation of lateral primordia. Recent research in various model species (Arabidopsis, tomato, maize, and rice) has led to discoveries of additional components that further refine and improve the current model of meristem regulation, adding new complexity to a vital network for plant growth and productivity.
Nature Methods | 2017
Shelly A. Trigg; Renee M. Garza; Andrew MacWilliams; Joseph R. Nery; Anna Bartlett; Rosa Castanon; Adeline Goubil; Joseph Feeney; Ronan O'Malley; Shao Shan C. Huang; Zhuzhu Z. Zhang; Mary Galli; Joseph R. Ecker
Broad-scale protein–protein interaction mapping is a major challenge given the cost, time, and sensitivity constraints of existing technologies. Here, we present a massively multiplexed yeast two-hybrid method, CrY2H-seq, which uses a Cre recombinase interaction reporter to intracellularly fuse the coding sequences of two interacting proteins and next-generation DNA sequencing to identify these interactions en masse. We applied CrY2H-seq to investigate sparsely annotated Arabidopsis thaliana transcription factors interactions. By performing ten independent screens testing a total of 36 million binary interaction combinations, and uncovering a network of 8,577 interactions among 1,453 transcription factors, we demonstrate CrY2H-seq′s improved screening capacity, efficiency, and sensitivity over those of existing technologies. The deep-coverage network resource we call AtTFIN-1 recapitulates one-third of previously reported interactions derived from diverse methods, expands the number of known plant transcription factor interactions by three-fold, and reveals previously unknown family-specific interaction module associations with plant reproductive development, root architecture, and circadian coordination.
Nature Protocols | 2017
Anna Bartlett; Ronan O'Malley; Shao-shan Carol Huang; Mary Galli; Joseph R. Nery; Andrea Gallavotti; Joseph R. Ecker
To enable low-cost, high-throughput generation of cistrome and epicistrome maps for any organism, we developed DNA affinity purification sequencing (DAP-seq), a transcription factor (TF)-binding site (TFBS) discovery assay that couples affinity-purified TFs with next-generation sequencing of a genomic DNA library. The method is fast, inexpensive, and more easily scaled than chromatin immunoprecipitation sequencing (ChIP-seq). DNA libraries are constructed using native genomic DNA from any source of interest, preserving cell- and tissue-specific chemical modifications that are known to affect TF binding (such as DNA methylation) and providing increased specificity as compared with in silico predictions based on motifs from methods such as protein-binding microarrays (PBMs) and systematic evolution of ligands by exponential enrichment (SELEX). The resulting DNA library is incubated with an affinity-tagged in vitro-expressed TF, and TF–DNA complexes are purified using magnetic separation of the affinity tag. Bound genomic DNA is eluted from the TF and sequenced using next-generation sequencing. Sequence reads are mapped to a reference genome, identifying genome-wide binding locations for each TF assayed, from which sequence motifs can then be derived. A researcher with molecular biology experience should be able to follow this protocol, processing up to 400 samples per week.
Genetics | 2017
Mithu Chatterjee; Qiujie Liu; Caitlin Menello; Mary Galli; Andrea Gallavotti
The micronutrient boron is essential in maintaining the structure of plant cell walls and is critical for high yields in crop species. Boron can move into plants by diffusion or by active and facilitated transport mechanisms. We recently showed that mutations in the maize boron efflux transporter ROTTEN EAR (RTE) cause severe developmental defects and sterility. RTE is part of a small gene family containing five additional members (RTE2–RTE6) that show tissue-specific expression. The close paralogous gene RTE2 encodes a protein with 95% amino acid identity with RTE and is similarly expressed in shoot and root cells surrounding the vasculature. Despite sharing a similar function with RTE, mutations in the RTE2 gene do not cause growth defects in the shoot, even in boron-deficient conditions. However, rte2 mutants strongly enhance the rte phenotype in soils with low boron content, producing shorter plants that fail to form all reproductive structures. The joint action of RTE and RTE2 is also required in root development. These defects can be fully complemented by supplying boric acid, suggesting that diffusion or additional transport mechanisms overcome active boron transport deficiencies in the presence of an excess of boron. Overall, these results suggest that RTE2 and RTE function are essential for maize shoot and root growth in boron-deficient conditions.