Anna K. Shchyolkina

Conformation and thermostability of oligonucleotide d(GGTTGGTGTGGTTGG) containing thiophosphoryl internucleotide bonds at different positions.

The thrombin-binding aptamer d(GGTTGGTGTGGTTGG) (TBA) is an efficient tool for the inhibition of thrombin function. We have studied conformations and thermodynamic stability of a number of modified TBA oligonucleotides containing thiophosphoryl substitution at different internucleotide sites. Using circular dichroism such modifications were found not to disrupt the antiparallel intramolecular quadruplex specific for TBA. Nevertheless, the presence of a single thiophosphoryl bond between two G-quartet planes led to a significant decrease in the quadruplex thermostability. On the contrary, modifications in each of the loop regions either stabilized an aptamer structure or did not reduce its stability. According to the thrombin time test, the aptamer with thio-modifications in both TT loops (LL11) exhibits the same antithrombin efficiency as the original TBA. This aptamer shows better stability against DNA nuclease compared to that of TBA. We conclude that such thio-modification patterns are very promising for the design of anticoagulation agents.

Synthesis, characterization and in vitro activity of thrombin-binding DNA aptamers with triazole internucleotide linkages

A series of DNA aptamers bearing triazole internucleotide linkages that bind to thrombin was synthesized. The novel aptamers are structurally analogous to the well-known thrombin-inhibiting G-quadruplexes TBA15 and TBA31. The secondary structure stability, binding affinity for thrombin and anticoagulant effects of the triazole-modified aptamers were measured. A modification in the central loop of the aptamer quadruplex resulted in increased nuclease resistance and an inhibition efficiency similar to that of TBA15. The likely aptamer-thrombin binding mode was determined by molecular dynamics simulations. Due to their relatively high activity and the increased resistance to nuclease digestion imparted by the triazole internucleotide linkages, the novel aptamers are a promising alternative to known DNA-based anticoagulant agents.

Parallel stranded DNA with AT base pairing

The concentration and temperature dependences of the UV and CD spectra of the oligonucleotide 3′‐d(ApTpApTpApTpApTpApTp)‐O(CH2)6O‐5′‐d(pApTpApTpApTpApTpApT) (eicosamer) in aqueous solution at pH 7 in the presence of 0.5 M NACl were studied. At less than 10−6 M, the eicosamer was shown to form in solution a hairpin with parallel orientation of chains (parallel hairpin). From thermal denaturation profiles [A 260(T)] the thermodynamic parameters, ΔH°, ΔS° and T m for parallel hairpin formation were calculated to be −90±8 kJ/mol. −300±20 J · mol−1 · K−1 and 40.5°C, respectively. The CD spectra of the parallel double helix differed from those of B‐form DNA and had characteristic features: decreasing magnitude of the positive maximum at 265 nm and a negative peak at 285 nm.

Southern molecular hybridization experiments with parallel complementary DNA probes

We have detected the specific binding in Southern blot hybridization experiments of both complementary antiparallel and parallel 40 bp synthetic DNA probes, corresponding to a cloned Drosophila DNA fragment. The highly cooperative annealing and melting were observed in solution with these probes, which are complementary in the same direction and possess 17 GC pairs. The binding of ethidium bromide is indicative of formation of a perfect parallel DNA duplex. The specific binding was also detected in both genomic and in plaque hybridization experiments.

Disordering of human telomeric G-quadruplex with novel antiproliferative anthrathiophenedione.

Linear heteroareneanthracenediones have been shown to interfere with DNA functions, thereby causing death of human tumor cells and their drug resistant counterparts. Here we report the interaction of our novel antiproliferative agent 4,11-bis[(2-{[acetimido]amino}ethyl)amino]anthra[2,3-b]thiophene-5,10-dione with telomeric DNA structures studied by isothermal titration calorimetry, circular dichroism and UV absorption spectroscopy. New compound demonstrated a high affinity (Kass∼106 M−1) for human telomeric antiparallel quadruplex d(TTAGGG)4 and duplex d(TTAGGG)4∶d(CCCTAA)4. Importantly, a ∼100-fold higher affinity was determined for the ligand binding to an unordered oligonucleotide d(TTAGGG TTAGAG TTAGGG TTAGGG unable to form quadruplex structures. Moreover, in the presence of Na+ the compound caused dramatic conformational perturbation of the telomeric G-quadruplex, namely, almost complete disordering of G-quartets. Disorganization of a portion of G-quartets in the presence of K+ was also detected. Molecular dynamics simulations were performed to illustrate how the binding of one molecule of the ligand might disrupt the G-quartet adjacent to the diagonal loop of telomeric G-quadruplex. Our results provide evidence for a non-trivial mode of alteration of G-quadruplex structure by tentative antiproliferative drugs.

Recombination R-triplex: H-bonds contribution to stability as revealed with minor base substitutions for adenine

Several cellular processes involve alignment of three nucleic acids strands, in which the third strand (DNA or RNA) is identical and in a parallel orientation to one of the DNA duplex strands. Earlier, using 2-aminopurine as a fluorescent reporter base, we demonstrated that a self-folding oligonucleotide forms a recombination-like structure consistent with the R-triplex. Here, we extended this approach, placing the reporter 2-aminopurine either in the 5′- or 3′-strand. We obtained direct evidence that the 3′-strand forms a stable duplex with the complementary central strand, while the 5′-strand participates in non-Watson–Crick interactions. Substituting 2,6-diaminopurine or 7-deazaadenine for adenine, we tested and confirmed the proposed hydrogen bonding scheme of the A*(T·A) R-type triplet. The adenine substitutions expected to provide additional H-bonds led to triplex structures with increased stability, whereas the substitutions consistent with a decrease in the number of H-bonds destabilized the triplex. The triplex formation enthalpies and free energies exhibited linear dependences on the number of H-bonds predicted from the A*(T·A) triplet scheme. The enthalpy of the 10 nt long intramolecular triplex of −100 kJ·mol−1 demonstrates that the R-triplex is relatively unstable and thus an ideal candidate for a transient intermediate in homologous recombination, t-loop formation at the mammalian telomere ends, and short RNA invasion into a duplex. On the other hand, the impact of a single H-bond, 18 kJ·mol−1, is high compared with the overall triplex formation enthalpy. The observed energy advantage of a ‘correct’ base in the third strand opposite the Watson–Crick base pair may be a powerful mechanism for securing selectivity of recognition between the single strand and the duplex.

Relative stability of AT and GC pairs in parallel DNA duplex formed by a natural sequence

The low‐cooperative melting of parallel DNA formed by a natural 40 bp long sequence from Drosophila: 5′‐d(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)‐3′ 5′‐d(ACTAACTAGCTAACAAACGTACGTGTGCAAAAACACTCGC)‐3′ that possesses a normal nucleotide content was studied by using the special method of measuring the fluorescence of its complex with acriflavine as well as by conventional thermal denaturation. Acriflavine allows discrimination of the melting of AT and GC pairs because its fluorescence is quenched by neighbouring G bases. We have observed that about 40% of AT pairs melt at 14°C while the remainder melt at 42°C. The GC pairs remain stable up to ∼ 40°C and melt at 54°C. The higher stability of GC pairs suggests the formation of cis Watson‐Crick pairs in parallel DNA.

Evidence for the tetraplex structure of the d(GT)n repetitive sequences in solution

The ability of oligonucleotides 3′‐d(GT)5pO(CH2)6Opd(GT)5‐5′(anti[d(GT)]) and 3′‐d(GT)5pO(CH2)6Opd(GT)5‐3′(par[d(GT)]) to form tertiary structures has been studied. Circular dichroism (CD) as well as the fluorescence of the ethidium bromide (E1Br) complexes with oligonucleotides and hydrodynamic volume measurements in solutions containing 0.01 M phosphate buffer, pH 7 and NACl in concentrations from 0.1 M to 1 M, have been used. The data obtained in the temperature interval from 30°C to 10°C are in good agreement with the structure suggested earlier [1] where the par[d(GT)] and anti[d(GT)] form structures with four parallel strands in which layers of four G‐residues alternate with unpaired bulged‐out T‐residues. Ethidium bromide interacts with the structure in a cooperative manner. Two ethidium bromide molecules intercalate between two layers of four G‐residues.

Parallel-Stranded DNA with Natural Base Sequences

Noncanonical parallel-stranded DNA double helices (ps-DNA) of natural nucleotide sequences are usually less stable than the canonical antiparallel-stranded DNA structures, which ensures reliable cell functioning. However, recent data indicate a possible role of ps-DNA in DNA loops or in regions of trinucleotide repeats connected with neurodegenerative diseases. The review surveys recent studies on the effect of nucleotide sequence on preference of one or other type of DNA duplex. (1) Ps-DNA of mixed AT/GC composition was found to have conformational and thermodynamic properties drastically different from those of a Watson–Crick double helix. Its stability depends strongly on the specific sequence in a manner peculiar to the ps double helix, because of the energy disadvantage of the AT/GC contacts. The AT/GC boundary facilitated flipping of A and T out of the ps double helix. Proton acceptor groups of bases are exposed into both grooves of the ps-DNA and are accessible to solvent and ligands, including proteins. (2) DNA regions containing natural minor bases isoguanine and isomethylisocytosine were shown to form ps-DNA with transAT-, trans isoGC, and transiso5meCG pairs exceeding in stability a related canonical duplex. (3) Nucleotide sequence dG(GT)4G from yeast telomeres and microsatellites was demonstrated to form novel ps-DNA with GG and TT base pairing. Unlike d(GT)n- and d(GnTm) sequences able to form quadruplexes, the dG(GT)4G sequence formed no alternative double- or multistranded structures in a wide range of experimental conditions, thus suggesting that the nucleotide context governs the observed structural polymorphism of the d(GT)n sequence. The possible biological role of ps-DNA and the prospects of its study are discussed.

Parallel purine-pyrimidine-purine triplex: experimental evidence for existence

Oligonucleotides 5′‐d(CT)5‐L‐d(AG)5‐L‐d(GA)5‐3′ and 5′‐d(GA)5‐L‐d(TC)5‐L‐d(GA)5‐3′ [L = pO(CH2CH2O)3p] were studied by thermal denaturation, chemical modification and binding of fluorescent dyes. Both oligonucleotides are shown to fold back on itself twice forming at pH 7 a sufficiently stable triplex ether with antiparallel‐oriented oligopurine strands (the first compound) or parallel‐oriented oligopurine strands (the second compounds). The parallel triplex is significantly less stable than the antiparallel one. On the basis of conformational modeling, possible types of base tripling in the triplets are proposed. Thus our data provide the first convincingly evidence for the existence of a purine‐pyrimidine‐purine triplex with parallel orientation of identical strands.