Boris K. Chernov

CC/GG Contacts Facilitate the B to A Transition of DMA in Solution

Self-complementary decadeoxynucleotides, CCGATATCGG, CCAGATCTGG, CCCTGCAGGG, GGGGGCCCCC, were designed and synthesized to estimate the A-philic free energy of CC/GG contacts. First, regions of temperature-stability of the double-stranded conformation were determined for each 10-mer. Then, circular dichroism spectra were recorded for the B-family forms at different temperatures, counter-ion concentrations and trifluoroethanol contents. A cooperative change typical of the B-A transition is observed in the CD spectra at a trifluoroethanol content specific for each duplex. The positions of half-transition points were functions not only of the nucleotide sequence but of the duplex length as well: the B to A transitions were hindered in these 10-mers in comparison with a lengthy DNA. The B-phility value was estimated to be 3 kcal/mol of 10-mer. The B-A transition point was shown to drop with an increase in the number of CC/GG contacts in a duplex. The designed 10-mers made it possible to estimate quantitatively the A-phility of CC/GG contact as compared with an average DNA: (FA-FB)CC = 0.2 Kcal/mol, (FA-FB)DNA = 0.7 Kcal/mol.

DNA SEQUENCE RECOGNITION BY BIS-LINKED NETROPSIN AND DISTAMYCIN DERIVATIVES

We studied the interaction of cis‐diammine Pt(II)‐bridged bis‐netropsin, cis‐diammine Pt(II)‐bridged bis‐distamycin and oligomethylene‐bridged bis‐netropsin with synthetic DNA fragments containing pseudosymmetrical AT‐rich nucleotide sequences and compared it with the interaction of the parent compounds netropsin and distamycin A. For fragments containing multiple blocks of (A/T)4 and (T/A)4 separated by zero, one, two and three GC‐base pairs, DNase I footprinting and CD spectroscopy studies reveal that 5′‐TTTTAAAA‐3′ is the strongest affinity binding site for cis‐diammine Pt(II)‐bridged bis‐netropsin and bis‐distamycin. They both bind less strongly to a DNA region containing the sequence 5′‐AAAATTTT‐3′. Netropsin, distamycin A and oligomethylene‐bridged bis‐netropsin exhibit far less sequence discrimination.

MUTANTS OF T7 RNA-POLYMERASE THAT ARE ABLE TO SYNTHESIZE BOTH RNA AND DNA

A mutant T7 RNA polymerase (T7 RNAP) having two amino‐acid substitutions (Y639F and S641A) is altered in its specificity towards nucleotide substrates, but is not affected in the specificity of its interaction with promoter and terminator sequences. The mutant enzyme gains the ability to utilize dNTPs and catalyze RNA and DNA synthesis from circular supercoiled plasmid DNA. DNA synthesis can also be initiated from a single stranded template using a DNA primer. Another T7 RNAP mutant having only the single substitution S641A loses RNA polymerase activity but is able to synthesize DNA.

Parallel stranded DNA with AT base pairing

The concentration and temperature dependences of the UV and CD spectra of the oligonucleotide 3′‐d(ApTpApTpApTpApTpApTp)‐O(CH2)6O‐5′‐d(pApTpApTpApTpApTpApT) (eicosamer) in aqueous solution at pH 7 in the presence of 0.5 M NACl were studied. At less than 10−6 M, the eicosamer was shown to form in solution a hairpin with parallel orientation of chains (parallel hairpin). From thermal denaturation profiles [A 260(T)] the thermodynamic parameters, ΔH°, ΔS° and T m for parallel hairpin formation were calculated to be −90±8 kJ/mol. −300±20 J · mol−1 · K−1 and 40.5°C, respectively. The CD spectra of the parallel double helix differed from those of B‐form DNA and had characteristic features: decreasing magnitude of the positive maximum at 265 nm and a negative peak at 285 nm.

Southern molecular hybridization experiments with parallel complementary DNA probes

We have detected the specific binding in Southern blot hybridization experiments of both complementary antiparallel and parallel 40 bp synthetic DNA probes, corresponding to a cloned Drosophila DNA fragment. The highly cooperative annealing and melting were observed in solution with these probes, which are complementary in the same direction and possess 17 GC pairs. The binding of ethidium bromide is indicative of formation of a perfect parallel DNA duplex. The specific binding was also detected in both genomic and in plaque hybridization experiments.

Relative stability of AT and GC pairs in parallel DNA duplex formed by a natural sequence

The low‐cooperative melting of parallel DNA formed by a natural 40 bp long sequence from Drosophila: 5′‐d(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)‐3′ 5′‐d(ACTAACTAGCTAACAAACGTACGTGTGCAAAAACACTCGC)‐3′ that possesses a normal nucleotide content was studied by using the special method of measuring the fluorescence of its complex with acriflavine as well as by conventional thermal denaturation. Acriflavine allows discrimination of the melting of AT and GC pairs because its fluorescence is quenched by neighbouring G bases. We have observed that about 40% of AT pairs melt at 14°C while the remainder melt at 42°C. The GC pairs remain stable up to ∼ 40°C and melt at 54°C. The higher stability of GC pairs suggests the formation of cis Watson‐Crick pairs in parallel DNA.

Transfer of foreign DNA into the cells of developing mouse embryos by microprojectile bombardment

Mouse cells of developing embryos at the 2–4 cell, morula and blastocyst stages, were bombarded by high velocity tungsten microprojectiles. About 70% of developing embryos survived the bombardment. The general embryo structure did not change as a result of the bombardment. Penetration of the tungsten microparticles into the embryo cell nuclei was found at all stages being investigated, and tungsten particle localization on mitotic chromosomes was demonstrated. The total DNA of the mice born from the bombarded embryos was analyzed by dot‐blot hybridization and PCR with post‐hybridization. The most important results were obtained in experiments with blastocysts. In three cases of blastocyst bombardment, the presence of transferred plasmid DNA (pSV3‐neo) was revealed. Transfected cells were shown to be located in the fetal membrane as well as in the embryo. The bombardment of mouse culture cells resulted in their transfection and the production of G418‐resistant clones.

Forum domain in Drosophila melanogaster cut locus possesses looped domains inside

We have studied the relationship between chromosomal forum domains and looped domains in the cut locus of Drosophila melanogaster . Forum domains were earlier detected by separation in pulsed-field gels of 50-150 kb chromosomal DNA fragments obtained after spontaneous non-random degradation of chromosomes. We have localized the boundary region where cleavage sites are scattered between two forum domains in the regulatory region of the cut locus. We have sequenced a 13 kb region spanning few kilobases from distal domain, the boundary region and part of the proximal forum domain where several scaffold associated regions (SARs) were observed. We conclude that forum domains and looped domains are physically different types of domains and belong to different levels of organization in eukaryotic chromosomes. The boundary region between the neighboring forum domains in the cut locus possesses the Doc element insertion and a micro-satellite stretch and thus might remind a small island of heterochromatin and correspond to so-called intercalary heterochromatin that is known to be located in the 7B1-2 band where the major part of the cut locus is reside.

Nonvolatile copolymer compositions for fabricating gel element microarrays.

By modifying polymer compositions and cross-linking reagents, we have developed a simple yet effective manufacturing strategy for copolymerized three-dimensional gel element arrays. A new gel-forming monomer, 2-(hydroxyethyl) methacrylamide (HEMAA), was used. HEMAA possesses low volatility and improves the stability of copolymerized gel element arrays to on-chip thermal cycling procedures relative to previously used monomers. Probe immobilization efficiency within the new polymer was 55%, equivalent to that obtained with acrylamide (AA) and methacrylamide (MA) monomers. Nonspecific binding of single-stranded targets was equivalent for all monomers. Increasing cross-linker chain length improved hybridization kinetics and end-point signal intensities relative to N,N-methylenebisacrylamide (Bis). The new copolymer formulation was successfully applied to a model orthopox array. Because HEMAA greatly simplifies gel element array manufacture, we expect it (in combination with new cross-linkers described here) to find widespread application in microarray science.

Interactions between cro repressor and the model specific binding site

Binding of λ phage cro repressor to the synthetic half of OR3, the most conservative half of the specific binding sites, was investigated by proton nuclear magnetic resonance spectroscopy. It was found that the α‐helical segment (27–36) of the protein was involved in specific interactions with the model binding site. The 3‐dimensional structure of cro repressor does not change noticeably upon complex formation. Intercalation can be excluded as a possible means of interaction.