Olga F. Borisova

Conformation and thermostability of oligonucleotide d(GGTTGGTGTGGTTGG) containing thiophosphoryl internucleotide bonds at different positions.

The thrombin-binding aptamer d(GGTTGGTGTGGTTGG) (TBA) is an efficient tool for the inhibition of thrombin function. We have studied conformations and thermodynamic stability of a number of modified TBA oligonucleotides containing thiophosphoryl substitution at different internucleotide sites. Using circular dichroism such modifications were found not to disrupt the antiparallel intramolecular quadruplex specific for TBA. Nevertheless, the presence of a single thiophosphoryl bond between two G-quartet planes led to a significant decrease in the quadruplex thermostability. On the contrary, modifications in each of the loop regions either stabilized an aptamer structure or did not reduce its stability. According to the thrombin time test, the aptamer with thio-modifications in both TT loops (LL11) exhibits the same antithrombin efficiency as the original TBA. This aptamer shows better stability against DNA nuclease compared to that of TBA. We conclude that such thio-modification patterns are very promising for the design of anticoagulation agents.

Synthesis, characterization and in vitro activity of thrombin-binding DNA aptamers with triazole internucleotide linkages

A series of DNA aptamers bearing triazole internucleotide linkages that bind to thrombin was synthesized. The novel aptamers are structurally analogous to the well-known thrombin-inhibiting G-quadruplexes TBA15 and TBA31. The secondary structure stability, binding affinity for thrombin and anticoagulant effects of the triazole-modified aptamers were measured. A modification in the central loop of the aptamer quadruplex resulted in increased nuclease resistance and an inhibition efficiency similar to that of TBA15. The likely aptamer-thrombin binding mode was determined by molecular dynamics simulations. Due to their relatively high activity and the increased resistance to nuclease digestion imparted by the triazole internucleotide linkages, the novel aptamers are a promising alternative to known DNA-based anticoagulant agents.

Disordering of human telomeric G-quadruplex with novel antiproliferative anthrathiophenedione.

Linear heteroareneanthracenediones have been shown to interfere with DNA functions, thereby causing death of human tumor cells and their drug resistant counterparts. Here we report the interaction of our novel antiproliferative agent 4,11-bis[(2-{[acetimido]amino}ethyl)amino]anthra[2,3-b]thiophene-5,10-dione with telomeric DNA structures studied by isothermal titration calorimetry, circular dichroism and UV absorption spectroscopy. New compound demonstrated a high affinity (Kass∼106 M−1) for human telomeric antiparallel quadruplex d(TTAGGG)4 and duplex d(TTAGGG)4∶d(CCCTAA)4. Importantly, a ∼100-fold higher affinity was determined for the ligand binding to an unordered oligonucleotide d(TTAGGG TTAGAG TTAGGG TTAGGG unable to form quadruplex structures. Moreover, in the presence of Na+ the compound caused dramatic conformational perturbation of the telomeric G-quadruplex, namely, almost complete disordering of G-quartets. Disorganization of a portion of G-quartets in the presence of K+ was also detected. Molecular dynamics simulations were performed to illustrate how the binding of one molecule of the ligand might disrupt the G-quartet adjacent to the diagonal loop of telomeric G-quadruplex. Our results provide evidence for a non-trivial mode of alteration of G-quadruplex structure by tentative antiproliferative drugs.

Relative stability of AT and GC pairs in parallel DNA duplex formed by a natural sequence

The low‐cooperative melting of parallel DNA formed by a natural 40 bp long sequence from Drosophila: 5′‐d(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)‐3′ 5′‐d(ACTAACTAGCTAACAAACGTACGTGTGCAAAAACACTCGC)‐3′ that possesses a normal nucleotide content was studied by using the special method of measuring the fluorescence of its complex with acriflavine as well as by conventional thermal denaturation. Acriflavine allows discrimination of the melting of AT and GC pairs because its fluorescence is quenched by neighbouring G bases. We have observed that about 40% of AT pairs melt at 14°C while the remainder melt at 42°C. The GC pairs remain stable up to ∼ 40°C and melt at 54°C. The higher stability of GC pairs suggests the formation of cis Watson‐Crick pairs in parallel DNA.

Evidence for the tetraplex structure of the d(GT)n repetitive sequences in solution

The ability of oligonucleotides 3′‐d(GT)5pO(CH2)6Opd(GT)5‐5′(anti[d(GT)]) and 3′‐d(GT)5pO(CH2)6Opd(GT)5‐3′(par[d(GT)]) to form tertiary structures has been studied. Circular dichroism (CD) as well as the fluorescence of the ethidium bromide (E1Br) complexes with oligonucleotides and hydrodynamic volume measurements in solutions containing 0.01 M phosphate buffer, pH 7 and NACl in concentrations from 0.1 M to 1 M, have been used. The data obtained in the temperature interval from 30°C to 10°C are in good agreement with the structure suggested earlier [1] where the par[d(GT)] and anti[d(GT)] form structures with four parallel strands in which layers of four G‐residues alternate with unpaired bulged‐out T‐residues. Ethidium bromide interacts with the structure in a cooperative manner. Two ethidium bromide molecules intercalate between two layers of four G‐residues.

Parallel-Stranded DNA with Natural Base Sequences

Noncanonical parallel-stranded DNA double helices (ps-DNA) of natural nucleotide sequences are usually less stable than the canonical antiparallel-stranded DNA structures, which ensures reliable cell functioning. However, recent data indicate a possible role of ps-DNA in DNA loops or in regions of trinucleotide repeats connected with neurodegenerative diseases. The review surveys recent studies on the effect of nucleotide sequence on preference of one or other type of DNA duplex. (1) Ps-DNA of mixed AT/GC composition was found to have conformational and thermodynamic properties drastically different from those of a Watson–Crick double helix. Its stability depends strongly on the specific sequence in a manner peculiar to the ps double helix, because of the energy disadvantage of the AT/GC contacts. The AT/GC boundary facilitated flipping of A and T out of the ps double helix. Proton acceptor groups of bases are exposed into both grooves of the ps-DNA and are accessible to solvent and ligands, including proteins. (2) DNA regions containing natural minor bases isoguanine and isomethylisocytosine were shown to form ps-DNA with transAT-, trans isoGC, and transiso5meCG pairs exceeding in stability a related canonical duplex. (3) Nucleotide sequence dG(GT)4G from yeast telomeres and microsatellites was demonstrated to form novel ps-DNA with GG and TT base pairing. Unlike d(GT)n- and d(GnTm) sequences able to form quadruplexes, the dG(GT)4G sequence formed no alternative double- or multistranded structures in a wide range of experimental conditions, thus suggesting that the nucleotide context governs the observed structural polymorphism of the d(GT)n sequence. The possible biological role of ps-DNA and the prospects of its study are discussed.

Parallel purine-pyrimidine-purine triplex: experimental evidence for existence

Oligonucleotides 5′‐d(CT)5‐L‐d(AG)5‐L‐d(GA)5‐3′ and 5′‐d(GA)5‐L‐d(TC)5‐L‐d(GA)5‐3′ [L = pO(CH2CH2O)3p] were studied by thermal denaturation, chemical modification and binding of fluorescent dyes. Both oligonucleotides are shown to fold back on itself twice forming at pH 7 a sufficiently stable triplex ether with antiparallel‐oriented oligopurine strands (the first compound) or parallel‐oriented oligopurine strands (the second compounds). The parallel triplex is significantly less stable than the antiparallel one. On the basis of conformational modeling, possible types of base tripling in the triplets are proposed. Thus our data provide the first convincingly evidence for the existence of a purine‐pyrimidine‐purine triplex with parallel orientation of identical strands.

Novel multi-targeting anthra[2,3-b]thiophene-5,10-diones with guanidine-containing side chains: Interaction with telomeric G-quadruplex, inhibition of telomerase and topoisomerase I and cytotoxic properties

Novel generations of antitumor anthraquinones are expected to be advantageous over the conventional chemotherapeutic agents. Previous structure-activity relationship studies demonstrated an importance of the positively charged side chains conjugated to anthra[2,3-b]thiophene-5,10-dione scaffolds. Exploring a role of individual side chain moieties in binding to the duplex and G-quadruplex DNA, modulation of telomerase and topoisomerase I activities, intracellular accumulation and cytostatic potency, we herein analyzed a series of reported and newly synthesized guanidine-containing derivatives of anthra[2,3-b]thiophene-5,10-dione. We found that the number of cationic side chains (namely, two) is critical for a tight interaction with human telomeric G-quadruplex (TelQ). Along with a larger drug-TelQ association constant, the telomerase attenuation by anthrathiophenediones with two basic groups in the side chains was more pronounced than by the analogs bearing one basic group. For mono-guanidinated compounds the substituent with the amino group in the side chain provided better TelQ affinity than the methylamine residue. The intracellular uptake of the mono-guanidino derivative with two side chains was >2-fold higher than the respective value for the bis(guanidino) derivative. This difference can explain a lower antiproliferative potency of bis(guanidine) containing compounds. Thus, the modifications of side chains of anthra[2,3-b]thiophene-5,10-dione differently modulated drug-target interactions and cellular effects. Nevertheless, the selected compound 11-(3-aminopropylamino)-4-(2-guanidinoethylamino)anthra[2,3-b]thiophene-5,10-dione 13 demonstrated a high affinity to TelQ and the ability to stabilize the quadruplex structure. These properties were paralleled by reasonable potency of 13 as a telomerase/topoisomerase I inhibitor and an antiproliferative agent. These results indicate that the structural elements of anthra[2,3-b]thiophene-5,10-dione derivatives can be balanced to yield a candidate for further preclinical study.

5,10,15,20-Tetra-(N-methyl-3-pyridyl)porphyrin destabilizes the antiparallel telomeric quadruplex d(TTAGGG)4

Abstract5,10,15,20-Tetra-(N-methyl-3-pyridyl)porphyrin (TMPyP3) is a DNA-binding derivative of porphyrins. A comparative study of the binding of this ligand to biologically significant DNA structures was performed. For this purpose, the interactions of TMPyP3 with the antiparallel telomeric G-quadruplex d(TTAGGG)4, oligonucleotide dTTAGGGTTAGAG(TTAGGG)2 (not forming a quadruplex structure), double-stranded d(AC)8 · d(GT)8, and single-stranded d(AC)8 and d(GT)8 DNA molecules have been studied. Analysis of absorption isotherms has demonstrated that the binding constants and the number of binding sites for the complexes TMPyP3: DNA increase in the following order: d(AC)8 < d(GT)8 < d(AC)8 · d(GT)8 = d(TTAGGG)4 < dTTAGGGTTAGAG(TTAGGG)2. It has been for the first time demonstrated that the constant for TMPyP3 binding to unfolded dTTAGGGTTAGAG(TTAGGG)2 strand (1.3 × 107 M−1) is approximately threefold higher than for the G-quadruplex d(TTAGGG)4 (4.7 × 106 M−1). Binding of two TMPyP3 molecules to d(TTAGGG)4 decreases the thermostability of G-quadruplex (ΔTm = −8°C). Circular dichroism spectra of the TMPyP3 complexes with d(TTAGGG)4 suggest that the ligand partially unfolds the G-quadruplex structure. Structural destabilization of the telomeric G-quadruplex by TMPyP3 can explain the relatively low activity of this ligand as a telomerase inhibitor and a low cytotoxicity for cultured tumor cells.

Complexes of telomeric oligonucleotide d(TTAGGG)4 with the new recombinant protein vector PGEk carrying nucleic acids into proliferating cells

A study was made of the complexation of the protein vector PGEk, which transfers nucleic acids into the nuclei of cancer cells, with phosphodiester d(TTAGGG)4 (TMO) and phosphorothioate Sd(TTAGGG)4 (TMS) oligonucleotides, which inhibit telomerase. PGEk (64 amino-acid residues) contains a hydrophobic domain that originates from the human epidermal growth factor (hEGF) and is responsible for the receptor-mediated transfer of PGEk across the cell membrane, and the hydrophilic domain, which is a nuclear localization signal (NLS) and serves to bind DNA and deliver it to the cell nucleus. Experiments were performed in 0.01-M Na-phosphate and 0.1-M NaCl at 37°C. An analysis of the circular dichroism (CD) spectra showed that TMO forms an antiparallel G-quadruplex, while TMS occurs in the form of unfolded strands. The number of PGEk molecules adsorbed on oligonucleotides was estimated from the quenching of PGEk fluorescence and the increase in its polarization upon titration with oligonucleotides. Adsorption isotherms were plotted in Scatchard coordinates. Adsorption of the first two PGEk molecules on TMO and TMS followed a noncooperative mechanism and was characterized by high association constants: K1(TMO) = (7 ± 1) · 107 M−1 and K1(TMS) = (3 (± 0.5) · 107 M−1. Further adsorption, up to five or six PGEk molecules per TMO molecule, showed high cooperation and K2(TMO) = (4.0 ± 1.5) · 106 M−1. Unlike TMO, TMS only weakly bound the third PGEk molecule: K2(TMS) = (8 ± 2) · 105 M−1. An analysis of the CD spectra showed that PGEk partly unfolded the G-quadruplex formed by TMO and did not have an effect on the single-stranded structure of TMS. The secondary structure of DNA and the number of protein subunits were established for the biologically active complexes PGEk-TMO and PGEk-TMS, which efficiently pass across the membrane of cancer cells and inhibit their proliferation.