Bo Thomsen
Aarhus University
Network
Latest external collaboration on country level. Dive into details by clicking on the dots.
Publication
Featured researches published by Bo Thomsen.
BMC Genomics | 2010
João Fadista; Bo Thomsen; Lars-Erik Holm; Christian Bendixen
BackgroundCopy number variations (CNVs), which represent a significant source of genetic diversity in mammals, have been shown to be associated with phenotypes of clinical relevance and to be causative of disease. Notwithstanding, little is known about the extent to which CNV contributes to genetic variation in cattle.ResultsWe designed and used a set of NimbleGen CGH arrays that tile across the assayable portion of the cattle genome with approximately 6.3 million probes, at a median probe spacing of 301 bp. This study reports the highest resolution map of copy number variation in the cattle genome, with 304 CNV regions (CNVRs) being identified among the genomes of 20 bovine samples from 4 dairy and beef breeds. The CNVRs identified covered 0.68% (22 Mb) of the genome, and ranged in size from 1.7 to 2,031 kb (median size 16.7 kb). About 20% of the CNVs co-localized with segmental duplications, while 30% encompass genes, of which the majority is involved in environmental response. About 10% of the human orthologous of these genes are associated with human disease susceptibility and, hence, may have important phenotypic consequences.ConclusionsTogether, this analysis provides a useful resource for assessment of the impact of CNVs regarding variation in bovine health and production traits.
PLOS ONE | 2008
João Fadista; Marianne Nygaard; Lars-Erik Holm; Bo Thomsen; Christian Bendixen
Recent studies of mammalian genomes have uncovered the extent of copy number variation (CNV) that contributes to phenotypic diversity, including health and disease status. Here we report a first account of CNVs in the pig genome covering part of the chromosomes 4, 7, 14, and 17 already sequenced and assembled. A custom tiling oligonucleotide array was used with a median probe spacing of 409 bp for screening 12 unrelated Duroc boars that are founders of a large family material. After a strict CNV calling pipeline, 37 copy number variable regions (CNVRs) across all four chromosomes were identified, with five CNVRs overlapping segmental duplications, three overlapping pig unigenes and one overlapping a RefSeq pig mRNA. This CNV snapshot analysis is the first of its kind in the porcine genome and constitutes the basis for a better understanding of porcine phenotypes and genotypes with the prospect of identifying important economic traits.
Biochemical Journal | 2002
Anne-M. Krogsdam; Curt A F Nielsen; Søren Neve; Dorte Holst; Torben Helledie; Bo Thomsen; Christian Bendixen; Susanne Mandrup; Karsten Kristiansen
The nuclear receptor corepressor (NCoR) was isolated as a peroxisome-proliferator-activated receptor (PPAR) delta interacting protein using the yeast two-hybrid system. NCoR interacted strongly with the ligand-binding domain of PPAR delta, whereas interactions with the ligand-binding domains of PPAR gamma and PPAR alpha were significantly weaker. PPAR-NCoR interactions were antagonized by ligands in the two-hybrid system, but were ligand-insensitive in in vitro pull-down assays. Interaction between PPAR delta and NCoR was unaffected by coexpression of retinoid X receptor (RXR) alpha. The PPAR delta-RXR alpha heterodimer bound to an acyl-CoA oxidase (ACO)-type peroxisome-proliferator response element recruited a glutathione S-transferase-NCoR fusion protein in a ligand-independent manner. Contrasting with most other nuclear receptors, PPAR delta was found to interact equally well with interaction domains I and II of NCoR. In transient transfection experiments, NCoR and the related silencing mediator for retinoid and thyroid hormone receptor (SMRT) were shown to exert a marked dose-dependent repression of ligand-induced PPAR delta-mediated transactivation; in addition, transactivation induced by the cAMP-elevating agent forskolin was efficiently reduced to basal levels by NCoR as well as SMRT coexpression. Our results suggest that the transactivation potential of liganded PPAR delta can be fine-tuned by interaction with NCoR and SMRT in a manner determined by the expression levels of corepressors and coactivators.
Genome Biology | 2007
Jan Gorodkin; Susanna Cirera; Jakob Hedegaard; Michael J. Gilchrist; Frank Panitz; Claus Jørgensen; Karsten Scheibye-Knudsen; Troels Arvin; Steen Lumholdt; Milena Sawera; Trine Green; Bente Nielsen; Jakob Hull Havgaard; Carina Rosenkilde; Jun-Jun Wang; Heng Li; Ruiqiang Li; Bin Liu; Songnian Hu; Wei Dong; Wei Li; Jun Qing Yu; Jian Wang; Hans-Henrik Stærfeldt; Rasmus Wernersson; Lone Madsen; Bo Thomsen; Henrik Hornshøj; Zhan Bujie; Xuegang Wang
BackgroundKnowledge of the structure of gene expression is essential for mammalian transcriptomics research. We analyzed a collection of more than one million porcine expressed sequence tags (ESTs), of which two-thirds were generated in the Sino-Danish Pig Genome Project and one-third are from public databases. The Sino-Danish ESTs were generated from one normalized and 97 non-normalized cDNA libraries representing 35 different tissues and three developmental stages.ResultsUsing the Distiller package, the ESTs were assembled to roughly 48,000 contigs and 73,000 singletons, of which approximately 25% have a high confidence match to UniProt. Approximately 6,000 new porcine gene clusters were identified. Expression analysis based on the non-normalized libraries resulted in the following findings. The distribution of cluster sizes is scaling invariant. Brain and testes are among the tissues with the greatest number of different expressed genes, whereas tissues with more specialized function, such as developing liver, have fewer expressed genes. There are at least 65 high confidence housekeeping gene candidates and 876 cDNA library-specific gene candidates. We identified differential expression of genes between different tissues, in particular brain/spinal cord, and found patterns of correlation between genes that share expression in pairs of libraries. Finally, there was remarkable agreement in expression between specialized tissues according to Gene Ontology categories.ConclusionThis EST collection, the largest to date in pig, represents an essential resource for annotation, comparative genomics, assembly of the pig genome sequence, and further porcine transcription studies.
The EMBO Journal | 1996
F Lenfant; R K Mann; Bo Thomsen; X Ling; Michael Grunstein
Nucleosomes prevent the recognition of TATA promoter elements by the basal transcriptional machinery in the absence of induction. However, while Saccharomyces cerevisiae histones H3 and H4 contain N‐terminal regions involved in the activation and repression of GAL1 and in the expression of heterochromatin‐like regions, the sequences involved in repressing basal transcription have not yet been identified. Here, we describe the mapping of new N‐terminal domains, in all four core histones (H2A, H2B, H3 and H4), required for the repression of basal, uninduced transcription. Basal transcription was monitored by the use of a GAL1 promoter‐URA3 reporter construct whose uninduced activity can be detected through cellular sensitivity to the drug, 5‐fluoroorotic acid. We have found for each histone that the N‐terminal sequences repressing basal activity are in a short region adjacent to the structured alpha‐helical core. Analysis of minichromosome DNA topology demonstrates that the basal domains are required for the proper folding of DNA around the chromosomal particle. Deletion of the basal domain at each histone significantly decreases plasmid superhelical density, which probably reflects a release of DNA from the constraints of the nucleosome into the linker region. This provides a means by which basal factors may recognize otherwise repressed regulatory elements.
Cell Reports | 2015
Michael Keane; Jeremy Semeiks; Andrew E. Webb; Yang I. Li; Víctor Quesada; Thomas Craig; Lone Bruhn Madsen; Sipko van Dam; David Brawand; Patrícia I. Marques; Pawel Michalak; Lin Kang; Jong Bhak; Hyung-Soon Yim; Nick V. Grishin; Nynne Hjort Nielsen; Mads Peter Heide-Jørgensen; Elias M. Oziolor; Cole W. Matson; George M. Church; Gary W. Stuart; John C. Patton; J. Craig George; Robert S. Suydam; Knud Larsen; Carlos López-Otín; Mary J. O’Connell; John W. Bickham; Bo Thomsen; João Pedro de Magalhães
Summary The bowhead whale (Balaena mysticetus) is estimated to live over 200 years and is possibly the longest-living mammal. These animals should possess protective molecular adaptations relevant to age-related diseases, particularly cancer. Here, we report the sequencing and comparative analysis of the bowhead whale genome and two transcriptomes from different populations. Our analysis identifies genes under positive selection and bowhead-specific mutations in genes linked to cancer and aging. In addition, we identify gene gain and loss involving genes associated with DNA repair, cell-cycle regulation, cancer, and aging. Our results expand our understanding of the evolution of mammalian longevity and suggest possible players involved in adaptive genetic changes conferring cancer resistance. We also found potentially relevant changes in genes related to additional processes, including thermoregulation, sensory perception, dietary adaptations, and immune response. Our data are made available online (http://www.bowhead-whale.org) to facilitate research in this long-lived species.
Molecular and Cellular Biology | 2001
Lumir Krejci; Jiri Damborsky; Bo Thomsen; Morten Duno; Christian Bendixen
ABSTRACT Recombination is important for the repair of DNA damage and for chromosome segregation during meiosis; it has also been shown to participate in the regulation of cell proliferation. In the yeastSaccharomyces cerevisiae, recombination requires products of the RAD52 epistasis group. The Rad51 protein associates with the Rad51, Rad52, Rad54, and Rad55 proteins to form a dynamic complex. We describe a new strategy to screen for mutations which cause specific disruption of the interaction between certain proteins in the complex, leaving other interactions intact. This approach defines distinct protein interaction domains and protein relationships within the Rad51 complex. Alignment of the mutations onto the constructed three-dimensional model of the Rad51 protein reveal possible partially overlapping interfaces for the Rad51-Rad52 and the Rad51-Rad54 interactions. Rad51-Rad55 and Rad51-Rad51 interactions are affected by the same spectrum of mutations, indicating similarity between the two modes of binding. Finally, the detection of a subset of mutations within Rad51 which disrupt the interaction with mutant Rad52 protein but activate the interaction with Rad54 suggests that dynamic changes within the Rad51 protein may contribute to an ordered reaction process.
The EMBO Journal | 1987
Bo Thomsen; S Mollerup; B J Bonven; R Frank; H Blöcker; O F Nielsen; O Westergaard
Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non‐transcribed spacers of r‐chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I‐DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3′ end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence‐specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8‐fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6‐kb fragment investigated; the sequence specific cleavage is increased 2‐ to 3‐fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(‐10) M.
Journal of Molecular Biology | 1988
Eigil Kjeldsen; Steen Mollerup; Bo Thomsen; Bjarne J. Bonven; Lars Bolund; Ole Westergaard
We have studied the effect of the antitumor drug, camptothecin, on the interaction of human topoisomerase I with DNA at the sequence level. At a low molar ratio of enzyme to DNA, cleavage is prominent and unique, located at a previously described hexadecameric recognition sequence, while a number of strong additional cleavage sites appear in the presence of the drug. Camptothecin stimulates cleavage at the recognition sequence less than twofold, whereas cleavage at the additional sites is stimulated up to 200-fold. Camptothecin greatly enhances the stability of the cleavable complexes formed at the additional sites, whereas the complex formed at the hexadecameric sequence is only marginally affected. Cleavage was eliminated at certain sites in the presence of camptothecin. Taken together these observations demonstrate that at least three types of potential eukaryotic topoisomerase I cleavage sites can be distinguished by the use of camptothecin. Comparison of the sequences at the additional cleavage sites in the presence of camptothecin reveals that the most frequently cleaved dinucleotide is TG with no consensus for the flanking nucleotides.
BMC Genomics | 2011
Bujie Zhan; João Fadista; Bo Thomsen; Jakob Hedegaard; Frank Panitz; Christian Bendixen
BackgroundIntegration of genomic variation with phenotypic information is an effective approach for uncovering genotype-phenotype associations. This requires an accurate identification of the different types of variation in individual genomes.ResultsWe report the integration of the whole genome sequence of a single Holstein Friesian bull with data from single nucleotide polymorphism (SNP) and comparative genomic hybridization (CGH) array technologies to determine a comprehensive spectrum of genomic variation. The performance of resequencing SNP detection was assessed by combining SNPs that were identified to be either in identity by descent (IBD) or in copy number variation (CNV) with results from SNP array genotyping. Coding insertions and deletions (indels) were found to be enriched for size in multiples of 3 and were located near the N- and C-termini of proteins. For larger indels, a combination of split-read and read-pair approaches proved to be complementary in finding different signatures. CNVs were identified on the basis of the depth of sequenced reads, and by using SNP and CGH arrays.ConclusionsOur results provide high resolution mapping of diverse classes of genomic variation in an individual bovine genome and demonstrate that structural variation surpasses sequence variation as the main component of genomic variability. Better accuracy of SNP detection was achieved with little loss of sensitivity when algorithms that implemented mapping quality were used. IBD regions were found to be instrumental for calculating resequencing SNP accuracy, while SNP detection within CNVs tended to be less reliable. CNV discovery was affected dramatically by platform resolution and coverage biases. The combined data for this study showed that at a moderate level of sequencing coverage, an ensemble of platforms and tools can be applied together to maximize the accurate detection of sequence and structural variants.